Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAGGTGCAAGTGACCATGTGCATCGGCGCGTGCCCGAGCCAGTTCCGGGCGGCAAACATGCACGCGCAGATCAAGACGAGCCTGCACCGCCTGAAGCCCGACACGGTGCCAGCGCCCTGCTGCGTGCCCGCCAGCTACAATCCCATGGTGCTCATTCAAAAGACCGACACCGGGGTGTCGCTCCAGACCTATGATGACTTGTTAGCCAAAGACTGCCACTGCATATGAGCAGTCCTGGTCCTTCCACTGTGCACCTGCGCGGAGGACGCGACCTCAGTTGTCCTGCCCTGTGGAATGGGCTCAAGGTTCCTGAGACACCCGATTCCTGCCCAAACAGCTGTATTTATATAAGTCTGTTATTTATTATTAATTTATTGGGGTGACCTTCTTGGGGACTCGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... GDF15(9518)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yixin Zhang et al.
Oncotarget, 8(22), 36531-36544 (2017-04-08)
Ischemia reperfusion (I/R) injury which inevitably occurs during heart transplantation is the major factor leading to organ failure and graft rejection. In order to develop new therapies to prevent I/R injury, we used both a murine heart transplantation model with
Maria Louca et al.
Cancers, 11(8) (2019-08-16)
Glioblastoma multiforme (GBM) is the most aggressive type of brain tumor due to its invasive phenotype. Ras suppressor 1 (RSU-1) is a cell-extracellular matrix adhesion protein and we recently found that it promotes cell invasion in aggressive cells and inhibits
Yanwei Lu et al.
Cell death & disease, 8(9), e3036-e3036 (2017-09-08)
CDP138, a CDK5 binding partner, regulates cell proliferation and migration. However, the mechanisms by which CDP138 functions in these processes remain unclear. In this study, we show that CDP138 is frequently overexpressed and that high levels of CDP138 are correlated
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU052901-20UG | 04061831343861 |
| EHU052901-50UG | 04061828338177 |