Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTGGGAACTCAGACCGTACCTTGCAACAAGATTCTTCTTTGGAGCAGAATAAAAGATCTGGCCCATCAGTTCACACAGGTCCAGCGGGACATGTTCACCCTGGAGGACACGCTGCTAGGCTACCTTGCTGATGACCTCACATGGTGTGGTGAATTCAACACTTCCAAAATAAACTATCAATCTTGCCCAGACTGGAGAAAGGACTGCAGCAACAACCCTGTTTCAGTATTCTGGAAAACGGTTTCCCGCAGGTTTGCAGAAGCTGCCTGTGATGTGGTCCATGTGATGCTCAATGGATCCCGCAGTAAAATCTTTGACAAAAACAGCACTTTTGGGAGTGTGGAAGTCCATAATTTGCAACCAGAGAAGGTTCAGACACTAGAGGCCTGGGTGATACATG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CD38(952)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yoshio Ogura et al.
Aging, 12(12), 11325-11336 (2020-06-09)
Mitochondrial oxidative stress is a significant contributor to the pathogenesis of diabetic kidney disease (DKD). We previously showed that mitochondrial oxidative stress in the kidneys of Zucker diabetic fatty rats is associated with a decreased intracellular NAD+/NADH ratio and NAD+-dependent
Cheng-Bo Song et al.
Journal of translational medicine, 18(1), 95-95 (2020-02-26)
Despite the effective antiretroviral treatment (ART) of HIV-infected individuals, HIV persists in a small pool. Central memory CD4+ T cells (Tcm) make a major contribution to HIV persistence. We found that unlike HLA-DR, CD38 is highly expressed on the Tcm
Longfei Gao et al.
Frontiers in cellular neuroscience, 13, 316-316 (2019-07-23)
Mitochondria are the critical organelles for energy metabolism and cell survival in eukaryotic cells. Recent studies demonstrated that mitochondria can intercellularly transfer between mammalian cells. In neural cells, astrocytes transfer mitochondria into neurons in a CD38-dependent manner. Here, using co-culture
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU053231-50UG | 04061828338498 |
| EHU053231-20UG | 04061828574032 |