Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AATGAAAGCTGCTGCCTTGTGAAGTGTCTCTTTGAGAATGTGGTCCCCATGAGCTACATGGTATATTTCAATTTCTTTGGGTGTGTTCTGCCCCCACTGCTTATAATGCTGGTGATCTACATTAAGATCTTCCTGGTGGCCTGCAGGCAGCTTCAGCGCACTGAGCTGATGGACCACTCGAGGACCACCCTCCAGCGGGAGATCCATGCAGCCAAGTCACTGGCCATGATTGTGGGGATTTTTGCCCTGTGCTGGTTACCTGTGCATGCTGTTAACTGTGTCACTCTTTTCCAGCCAGCTCAGGGTAAAAATAAGCCCAAGTGGGCAATGAATATGGCCATTCTTCTGTCACATGCCAATTCAGTTGTCAATCCCATTGTCTATGCTTACCGGAACCGAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ADORA2B(136)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Alisha Wehdnesday Bernardo Reyes et al.
Veterinary microbiology, 242, 108586-108586 (2020-03-04)
Brucella as a stealthy intracellular pathogen avoids activation of innate immune response. Here we investigated the contribution of an adenosine receptor, Adora2b, during Brucella infection in professional phagocyte RAW 264.7 cells and in a murine model. Adora2b-deficient cells showed attenuated
Max Wilkat et al.
International journal of cancer, 147(1), 202-217 (2019-12-18)
Adenosine is a signaling molecule that exerts dual effects on tumor growth: while it inhibits immune cell function and thereby prevents surveillance by the immune system, it influences tumorigenesis directly via activation of adenosine receptors on tumor cells at the
J S Long et al.
Oncogene, 34(40), 5152-5162 (2015-02-11)
Tumour cells often acquire the ability to escape cell death, a key event leading to the development of cancer. In almost half of all human cancers, the capability to induce cell death is reduced by the mutation and inactivation of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU053361-50UG | 04061828338610 |
| EHU053361-20UG | 04061828574155 |