Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCTCAGACTGGTCCGAATCCACGCCTAGCCCAGCCACTGCCACTGGGGCCATGGCCACCACCACTGGGGCACTGCCTGCCCAGCCACTTCCCTTGTCTGTTCCCAGCTCCCTTGCTCAGGCCCAGACCCAGCTGGGGCCCCAGCCGGAAGTTACCCCCAAGAGGCAAGTGTTGGCCTGAGACGCTCGTCAGTTCTTAGATCTTGGGGGCCTAAAGAGACCCCCGTCCTGCCTCCTTTCTTTCTCTGTCTCTTCCTTCCTTTTAGTCTTTTTCATCCTCTTCTCTTTCCACCAACCCTCCTGCATCCTTGCCTTGCAGCGTGACCGAGATAGGTCATCAGCCCAGGGCTTCAGTCTTCCTTTATTTATAATGGGTGGGGGCTACCACCCACCCTCTCAGTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NOTCH3(4854)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Human iPS cell-derived mural cells as an in vitro model of hereditary cerebral small vessel disease.
Yumi Yamamoto et al.
Molecular brain, 13(1), 38-38 (2020-03-20)
Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is one of the most common forms of hereditary cerebral small vessel diseases and is caused by mutations in NOTCH3. Our group has previously reported incorporation of NOTCH3 extracellular domain
Yash R Somnay et al.
Cancer, 123(5), 769-782 (2016-11-20)
Thyroid tumorigenesis is characterized by a progressive loss of differentiation exhibited by a range of disease variants. The Notch receptor family (1-4) regulates developmental progression in both normal and cancerous tissues. This study sought to characterize the third Notch isoform
Keito Okazaki et al.
Nature communications, 11(1), 5911-5911 (2020-11-22)
Transcriptional dysregulation, which can be caused by genetic and epigenetic alterations, is a fundamental feature of many cancers. A key cytoprotective transcriptional activator, NRF2, is often aberrantly activated in non-small cell lung cancers (NSCLCs) and supports both aggressive tumorigenesis and
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU055111-50UG | 04061831362732 |
| EHU055111-20UG | 04061831344196 |