Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCAATGAGAAGCACGACCTTCATGTTACCTCCCAGCAGGGCAGCAGTGAACCAGTTGTCCAAGACCTGGCCCAGGTTGTTGAAGAGGTCATAGGGGTTCCACAGTCTTTTCAGAAACTCATATTTAAGGGAAAATCTCTGAAGGAAATGGAAACACCGTTGTCAGCACTTGGAATACAAGATGGTTGCCGGGTCATGTTAATTGGGAAAAAGAACAGTCCACAGGAAGAGGTTGAACTAAAGAAGTTGAAACATTTGGAGAAGTCTGTGGAGAAGATAGCTGACCAGCTGGAAGAGTTGAATAAAGAGCTTACTGGAATCCAGCAGGGTTTTCTGCCCAAGGATTTGCAAGCTGAAGCTCTCTGCAAACTTGATAGGAGAGTAAAAGCCACAATAGAGCAGTTTATGAAGATCTTGGAGGAGATTGACACACTGATCCTGCCAGAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... BAG1(573)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Shutong Liu et al.
Journal of translational medicine, 15(1), 189-189 (2017-09-08)
In order to improve therapy for head and neck squamous cell carcinoma (HNSCC), biomarkers associated with local and/or distant tumor relapses and cancer drug resistance are urgently needed. This study identified a potential biomarker, Bcl-2 associated athanogene-1 (BAG-1), that is
Pelin Ozfiliz Kilbas et al.
Molecular biology reports, 46(1), 847-860 (2019-01-21)
The multifunctional anti-apoptotic Bag-1 protein has important roles in apoptosis, proteasome-mediated degradation, transcriptional regulation, and intracellular signaling. Bag-1 promotes cell survival and proliferation, and is overexpressed in breast cancer. Therefore, Bag-1-targeted therapy might be a promising strategy to treat breast
Zhili Shen et al.
Molecular medicine reports, 17(5), 7435-7441 (2018-03-24)
Cinobufacini is widely used in the treatment of advanced cancers. It has been previously reported that microRNA (miR)‑494 was upregulated in cinobufacini‑treated gastric cancer cells; however, the detailed role of miR‑494 in the anti‑tumor activity of cinobufacini is unclear. The
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU055401-20UG | 04061828558544 |
| EHU055401-50UG | 04061831362749 |