Skip to Content
Merck
CN

EHU055781

MISSION® esiRNA

targeting human LATS2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human LATS2

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGCCTTGCTTGTAAGGTGGACACTCACGCCCTGTACGCCATGAAGACCCTAAGGAAAAAGGATGTCCTGAACCGGAATCAGGTGGCCCACGTCAAGGCCGAGAGGGACATCCTGGCCGAGGCAGACAATGAGTGGGTGGTCAAACTCTACTACTCCTTCCAAGACAAAGACAGCCTGTACTTTGTGATGGACTACATCCCTGGTGGGGACATGATGAGCCTGCTGATCCGGATGGAGGTCTTCCCTGAGCACCTGGCCCGGTTCTACATCGCAGAGCTGACTTTGGCCATTGAGAGTGTCCACAAGATGGGCTTCATCCACCGAGACATCAAGCCTGATAACATTTTGATAGATCTGGATGGTCACATTAAACTCACAGATTTCGGCCTCTGCACTGGGTTCAGGTGGACTCACAATTCCAAATATTACCAGAAAGGGAGCCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ke Wang et al.
International journal of molecular medicine, 47(4) (2021-02-13)
Long non‑coding RNAs (lncRNAs) are a class of non‑protein coding transcripts that are involved in the regulation of gene expression in mammalian cells. Transcriptional co‑activator Yes associated protein 1 (YAP1) plays a key role in the progression of ovarian cancer.
Cédric Belair et al.
Silence, 2(1), 7-7 (2011-10-27)
MicroRNAs, post-transcriptional regulators of eukaryotic gene expression, are implicated in host defense against pathogens. Viruses and bacteria have evolved strategies that suppress microRNA functions, resulting in a sustainable infection. In this work we report that Helicobacter pylori, a human stomach-colonizing
Cong Dong et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 44(6), 475-481 (2015-03-19)
Many reports indicated LATS2 was a component of the Hippo pathway, could phosphorylate and inactivate YAP, acted as a tumor suppressor in human cancers. But few studies investigated the role of LATS2 in oral squamous cell carcinoma (OSCC) and clarified
Tone B Enger et al.
Laboratory investigation; a journal of technical methods and pathology, 93(11), 1203-1218 (2013-10-02)
Sjogren's syndrome (SS) is a complex autoimmune disease that primarily affects salivary and lacrimal glands and is associated with high morbidity. Although the prevailing dogma is that immune system pathology drives SS, increasing evidence points to structural defects, including defective
Chunbo He et al.
EMBO reports, 20(3) (2019-02-14)
Dysfunction of the homeostasis-maintaining systems in specific cell types or tissues renders the organism susceptible to a range of diseases, including cancers. One of the emerging mechanisms for maintaining tissue homeostasis is cellular senescence. Here, we report that the Hippo

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service