Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGTCCGTGGGCATCATGTTGACCGAGCTGGAGAAAGCCTTGAACTCTATCATCGACGTCTACCACAAGTACTCCCTGATAAAGGGGAATTTCCATGCCGTCTACAGGGATGACCTGAAGAAATTGCTAGAGACCGAGTGTCCTCAGTATATCAGGAAAAAGGGTGCAGACGTCTGGTTCAAAGAGTTGGATATCAACACTGATGGTGCAGTTAACTTCCAGGAGTTCCTCATTCTGGTGATAAAGATGGGCGTGGCAGCCCACAAAAAAAGCCATGAAGAAAGCCACAAAGAGTAGCTGAGTTACTGGGCCCAGAGGCTGGGCCCCTGGACATGTACCTGCAGAATAATAAAGTCATCAA
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... S100A8(6279)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chih-Ru Lin et al.
American journal of respiratory cell and molecular biology, 60(3), 299-307 (2018-10-03)
Pulmonary emphysema is characterized by alveolar wall destruction, and cigarette smoking is the main risk factor in this disease development. S100A8 is a member of the S100 protein family, with an oxidative stress-related and antiinflammatory role. The mechanisms of human
S Y Lim et al.
Oncogene, 35(44), 5735-5745 (2016-11-04)
Myeloid cells promote the development of distant metastases, but little is known about the molecular mechanisms underlying this process. Here we have begun to uncover the effects of myeloid cells on cancer cells in a mouse model of liver metastasis.
Hypoxia-Induced S100A8 Expression Activates Microglial Inflammation and Promotes Neuronal Apoptosis.
Ji Sun Ha et al.
International journal of molecular sciences, 22(3) (2021-02-04)
S100 calcium-binding protein A8 (S100A8), a danger-associated molecular pattern, has emerged as an important mediator of the pro-inflammatory response. Some S100 proteins play a prominent role in neuroinflammatory disorders and increase the secretion of pro-inflammatory cytokines in microglial cells. The
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU056941-20UG | 04061828559961 |
| EHU056941-50UG | 04061828314089 |