Skip to Content
Merck
CN

EHU056941

MISSION® esiRNA

targeting human S100A8

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTCCGTGGGCATCATGTTGACCGAGCTGGAGAAAGCCTTGAACTCTATCATCGACGTCTACCACAAGTACTCCCTGATAAAGGGGAATTTCCATGCCGTCTACAGGGATGACCTGAAGAAATTGCTAGAGACCGAGTGTCCTCAGTATATCAGGAAAAAGGGTGCAGACGTCTGGTTCAAAGAGTTGGATATCAACACTGATGGTGCAGTTAACTTCCAGGAGTTCCTCATTCTGGTGATAAAGATGGGCGTGGCAGCCCACAAAAAAAGCCATGAAGAAAGCCACAAAGAGTAGCTGAGTTACTGGGCCCAGAGGCTGGGCCCCTGGACATGTACCTGCAGAATAATAAAGTCATCAA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chih-Ru Lin et al.
American journal of respiratory cell and molecular biology, 60(3), 299-307 (2018-10-03)
Pulmonary emphysema is characterized by alveolar wall destruction, and cigarette smoking is the main risk factor in this disease development. S100A8 is a member of the S100 protein family, with an oxidative stress-related and antiinflammatory role. The mechanisms of human
S Y Lim et al.
Oncogene, 35(44), 5735-5745 (2016-11-04)
Myeloid cells promote the development of distant metastases, but little is known about the molecular mechanisms underlying this process. Here we have begun to uncover the effects of myeloid cells on cancer cells in a mouse model of liver metastasis.
Li Zhang et al.
Oncology reports, 45(1), 151-158 (2020-11-11)
B‑cell lymphomas (BCLs) are malignant lymphoid tumours originating from the malignant proliferation and transformation of mature lymphocytes at various stages of differentiation and clonal expansion of the lymphatic and circulatory systems. Efforts to control or even eradicate BCLs are frequently
Ji Sun Ha et al.
International journal of molecular sciences, 22(3) (2021-02-04)
S100 calcium-binding protein A8 (S100A8), a danger-associated molecular pattern, has emerged as an important mediator of the pro-inflammatory response. Some S100 proteins play a prominent role in neuroinflammatory disorders and increase the secretion of pro-inflammatory cytokines in microglial cells. The
Ming Li et al.
Hypertension in pregnancy, 39(2), 126-138 (2020-03-24)
Objectives: The protective effects of interleukin(IL)-35 against injury to human umbilical vein endothelial cells (HUVECs) induced by the serum of pre-eclampsia patients were analyzed.Methods: This cross-sectional study included 24 patients with pre-eclampsia (PE) and 24 normotensive pregnant women.Results: Compared to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service