Skip to Content
Merck
CN

EHU057151

MISSION® esiRNA

targeting human TMEM37

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCGGTCTCCATTTGTGATGGGCACTGGCTCCTGGCTGAGGACCGCCTCTTCGGGCTCTGGCACTTCTGCACCACCACCAACCAGACGATCTGCTTCAGAGACCTGGGCCAGGCCCATGTGCCCGGGCTGGCCGTGGGCATGGGCCTGGTACGCAGCGTGGGCGCCTTGGCCGTGGTGGCCGCCATTTTTGGCCTGGAGTTCCTCATGGTGTCCCAGTTGTGCGAGGACAAACACTCACAGTGCAAGTGGGTCATGGGTTCCATCCTCCTCCTGGTGTCTTTCGTCCTCTCCTCCGGCGGGCTCCTGGGTTTTGTGATCCTCCTCAGGAACCAAGTCACACTCATCGGCTTCACCCTAATGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Katherine R Walter et al.
Molecular cancer research : MCR, 15(10), 1331-1340 (2017-07-08)
The progesterone receptor (PR) regulates transcriptional programs that drive proliferation, survival, and stem cell phenotypes. Although the role of native progesterone in the development of breast cancer remains controversial, PR clearly alters the transcriptome in breast tumors. This study identifies
Shimeng Liu et al.
Oncogene, 38(15), 2722-2735 (2018-12-13)
Progesterone and its receptor, PR, are essential for uterine leiomyoma (LM, a.k.a., fibroid) tumorigenesis, but the underlying cellular and molecular mechanisms remain unclear. The receptor activator of NF-κB (RANKL) was recently identified as a novel progesterone/PR-responsive gene that plays an
Sijie Tan et al.
Experimental cell research, 382(1), 111433-111433 (2019-05-18)
Autophagy is an evolutionary conserved, self-eating process that targets cellular constituents for lysosomal degradation. Transcription factor EB (TFEB) is a master regulator of autophagy by inducing the expression of genes involved in autophagic and lysosomal degradation. In breast cancer, ligand-activated
Yingke Zhao et al.
Oxidative medicine and cellular longevity, 2020, 7635291-7635291 (2020-10-31)
Progesterone receptor (PR) modulates neuroprotective and regenerative responses in Parkinson's disease and related neurological diseases. The present study was designed to determine whether botanical drug puerarin could exhibit neuroprotective and neurorestorative activities via PR signaling. The neuroprotective and neurotrophic activities
Anke Schennink et al.
Reproductive toxicology (Elmsford, N.Y.), 54, 93-100 (2014-12-03)
The voluntary consumption of alcohol by humans is a modifiable lifestyle factor that has been consistently linked to a woman's risk of developing breast cancer. We have used an animal model that closely recapitulates breast development in humans to study

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service