Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTCGGTCTCCATTTGTGATGGGCACTGGCTCCTGGCTGAGGACCGCCTCTTCGGGCTCTGGCACTTCTGCACCACCACCAACCAGACGATCTGCTTCAGAGACCTGGGCCAGGCCCATGTGCCCGGGCTGGCCGTGGGCATGGGCCTGGTACGCAGCGTGGGCGCCTTGGCCGTGGTGGCCGCCATTTTTGGCCTGGAGTTCCTCATGGTGTCCCAGTTGTGCGAGGACAAACACTCACAGTGCAAGTGGGTCATGGGTTCCATCCTCCTCCTGGTGTCTTTCGTCCTCTCCTCCGGCGGGCTCCTGGGTTTTGTGATCCTCCTCAGGAACCAAGTCACACTCATCGGCTTCACCCTAATGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TMEM37(140738)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Katherine R Walter et al.
Molecular cancer research : MCR, 15(10), 1331-1340 (2017-07-08)
The progesterone receptor (PR) regulates transcriptional programs that drive proliferation, survival, and stem cell phenotypes. Although the role of native progesterone in the development of breast cancer remains controversial, PR clearly alters the transcriptome in breast tumors. This study identifies
Shimeng Liu et al.
Oncogene, 38(15), 2722-2735 (2018-12-13)
Progesterone and its receptor, PR, are essential for uterine leiomyoma (LM, a.k.a., fibroid) tumorigenesis, but the underlying cellular and molecular mechanisms remain unclear. The receptor activator of NF-κB (RANKL) was recently identified as a novel progesterone/PR-responsive gene that plays an
Sijie Tan et al.
Experimental cell research, 382(1), 111433-111433 (2019-05-18)
Autophagy is an evolutionary conserved, self-eating process that targets cellular constituents for lysosomal degradation. Transcription factor EB (TFEB) is a master regulator of autophagy by inducing the expression of genes involved in autophagic and lysosomal degradation. In breast cancer, ligand-activated
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU057151-20UG | 04061828560158 |
| EHU057151-50UG | 04061828314287 |