Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGATAAGCACGTTGCAGGAGCTGATGGCAGGGCCTGGGCACTTTAACCCCTACAGGTATGTGGTGGTATCAGTGACCAATGTCATCTGTGCCATTTGCTTTGGCCGGCGCTATGACCACAACCACCAAGAACTGCTTAGCCTAGTCAACCTGAATAATAATTTCGGGGAGGTGGTTGGCTCTGGAAACCCAGCTGACTTCATCCCTATTCTTCGCTACCTACCCAACCCTTCCCTGAATGCCTTCAAGGACCTGAATGAGAAGTTCTACAGCTTCATGCAGAAGATGGTCAAGGAGCACTACAAAACCTTTGAGAAGGGCCACATCCGGGACATCACAGACAGCCTGATTGAGCACTGTCAGGAGAAGCAGCTGGATGAGAACGCCAATGTCCAGCTGTCAGATGAGAAGATCATTAACATCGTCTTGGACCTCTTTGGAGCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CYP1A1(1543)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hanna Piotrowska-Kempisty et al.
Toxicology letters, 267, 59-66 (2017-01-04)
The role of CYP1A1 and CYP1B1 enzymes in the biotransformation and biological activity of the methylated resveratrol analogue, 3,4,5,4'-tetramethoxystilbene (DMU-212) is still elusive. Our recently published data have shown that one of the metabolites of DMU-212, 3'-hydroxy-3,4,5,4'-tetramethoxystilbene (DMU-214) exerts more
Marta Vuerich et al.
Journal of hepatology, 74(1), 48-57 (2020-07-15)
In autoimmune hepatitis (AIH), the imbalance between regulatory T cells (Tregs) and T-helper type 17 (Th17) cells has been linked to low levels of CD39, an ectoenzyme that hydrolyses ATP, ultimately generating immunosuppressive adenosine. Upregulation of CD39 results from activation
Laura MacPherson et al.
International journal of molecular sciences, 15(5), 7939-7957 (2014-05-09)
The aryl hydrocarbon receptor (AHR) regulates the toxic effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The AHR repressor (AHRR) is an AHR target gene and functions as a ligand-induced repressor of AHR; however, its mechanism of inhibition is controversial. Recently, we reported that
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU058161-50UG | 04061828325450 |
| EHU058161-20UG | 04061828560608 |