Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTGGTCATGGAGAGCAGCTTCCAAATCACAGAGGAGACCCAGATTGACACCACCCTGCGGCGCAGCCAGATGTCCCCCCAAGGCCTGCGGGTCCGTCTGCGGCCCGGTGAGGAGCGGCATTTTGAGCTGGAGGTGTTTGAGCCACTGGAGAGCCCCGTGGACCTGTACATCCTCATGGACTTCTCCAACTCCATGTCCGATGATCTGGACAACCTCAAGAAGATGGGGCAGAACCTGGCTCGGGTCCTGAGCCAGCTCACCAGCGACTACACTATTGGATTTGGCAAGTTTGTGGACAAAGTCAGCGTCCCGCAGACGGACATGAGGCCTGAGAAGCTGAAGGAGCCCTGGCCCAACAGTGACCCCCCCTTCTCCTTCAAGAACGTCATCAGCCTGACAGAAGATGTGGATGAGTTCCGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ITGB4(3691)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xiangli Meng et al.
Bosnian journal of basic medical sciences, 20(1), 106-116 (2019-06-27)
Pancreatic cancer is the fourth leading cause of cancer death, with a 5-year survival rate of only 1-4%. Integrin-mediated cell adhesion is critical for the initiation, progression, and metastasis of cancer. In this study we investigated the role of integrin
Jin Sol Sung et al.
Oncogene, 39(3), 664-676 (2019-09-20)
Integrin beta 4 (ITGB4) overexpression in cancer cells contributes to cancer progression. However, the role of stromal ITGB4 expression in cancer progression remains poorly understood, despite stromal ITGB4 overexpression in malignant cancers. In our study, ITGB4-overexpressing triple negative breast cancer
Rachel Evans et al.
Cell reports, 27(7), 1967-1978 (2019-05-16)
Lymphatic vasculature is crucial for metastasis in triple-negative breast cancer (TNBC); however, cellular and molecular drivers controlling lymphovascular metastasis are poorly understood. We define a macrophage-dependent signaling cascade that facilitates metastasis through lymphovascular remodeling. TNBC cells instigate mRNA changes in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU059511-50UG | 04061828326082 |
| EHU059511-20UG | 04061831344653 |