Skip to Content
Merck
CN

EHU061431

MISSION® esiRNA

targeting human TNFRSF10B

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human TNFRSF10B

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACGCTGGGAGAGAGACTTGCCAAGCAGAAGATTGAGGACCACTTGTTGAGCTCTGGAAAGTTCATGTATCTAGAAGGTAATGCAGACTCTGCCATGTCCTAAGTGTGATTCTCTTCAGGAAGTCAGACCTTCCCTGGTTTACCTTTTTTCTGGAAAAAGCCCAACTGGACTCCAGTCAGTAGGAAAGTGCCACAATTGTCACATGACCGGTACTGGAAGAAACTCTCCCATCCAACATCACCCAGTGGATGGAACATCCTGTAACTTTTCACTGCACTTGGCATTATTTTTATAAGCTGAATGTGATAATAAGGACACTATGGAAATGTCTGGATCATTCCGTTTGTGCGTACTTTGAGATTTGGTTTGGGATGTCATTGTTTTCACAGCACTTTTTTATCCTAATGTAAATGCTTTATTTATTTATTTGGGCTACATTGTAAGATCCATCTACACAGTCGTTGTCCGACTTCACTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mi Hee Park et al.
Biochemical and biophysical research communications, 473(2), 586-592 (2016-04-02)
We investigated whether bakuchiol, an analog of resveratrol enhances the apoptosis ability of tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) in cancer cells. Bakuchiol enhanced expression of cell death receptor (DR) in TRAIL-sensitive and -resistant colon cancer cells in a
Yongqing Liu et al.
Oncology letters, 15(3), 2871-2880 (2018-02-13)
Retigeric acid B (RAB), a natural compound isolated from lichen, has been demonstrated to inhibit cell growth and promote apoptosis in prostate cancer (PCa) cells. The present study evaluated the function of RAB combined with clinical chemotherapeutic drugs in PCa
Jiping Wang et al.
Cancer biology & therapy, 20(7), 979-988 (2019-04-18)
Glioblastoma is a highly malignant and typically fatal tumor of the central nervous system. The tumor is characterized by marked cellular and molecular heterogeneity, including a subpopulation of brain tumor initiating cells (BTICs) that are highly resistant to radiation and
Su-Been Lee et al.
Biomolecules, 10(3) (2020-03-28)
Prostaglandin (PG) A2, one of cyclopentenone PGs, is known to induce activation of apoptosis in various cancer cells. Although PGA2 has been reported to cause activation of apoptosis by altering the expression of apoptosis-related genes, the role of p53, one
Fanyun Kong et al.
Virology journal, 12, 192-192 (2015-11-19)
HBV X protein (HBX) is associated with cell apoptosis mediated by TNF-α related apoptosis inducing ligand (TRAIL), while the role of HBX on the expressions of TRAIL receptors death receptor 4 (DR4) and DR5 are unclear. In this study, we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service