Skip to Content
Merck
CN

EHU061621

MISSION® esiRNA

targeting human PAX8

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAAGATCCTTGGCAGGTACTACGAGACTGGCAGCATCCGGCCTGGAGTGATAGGGGGCTCCAAGCCCAAGGTGGCCACCCCCAAGGTGGTGGAGAAGATTGGGGACTACAAACGCCAGAACCCTACCATGTTTGCCTGGGAGATCCGAGACCGGCTCCTGGCTGAGGGCGTCTGTGACAATGACACTGTGCCCAGTGTCAGCTCCATTAATAGAATCATCCGGACCAAAGTGCAGCAACCATTCAACCTCCCTATGGACAGCTGCGTGGCCACCAAGTCCCTGAGTCCCGGACACACGCTGATCCCCAGCTCAGCTGTAACTCCCCCGGAGTCACCCCAGTCGGATTCCCTGGGCTCCACCTACTCCATCAATGGGCTCCTGGGCATCGCTCAGCCTGGCAGCGACAAGAGGAAAATGGATGACAGTGATCAGGATAGCTGCCGACTAAGCATTGACTCACAGAGCAGCAGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hui Tong et al.
Aging, 12(1), 70-79 (2020-01-10)
Long noncoding RNAs play vital roles in several biological processes, including cell growth and embryonic development. We showed that MACC1-AS1 was overexpressed in hepatocellular carcinoma (HCC) cells and tissues. The MACC1-AS1 expression level was dramatically upregulated in HCC samples compared
Laura R Hardy et al.
Oncogene, 38(32), 6003-6016 (2019-07-13)
High grade serous ovarian cancer (HGSOC) is the fifth leading cause of cancer deaths among women yet effective targeted therapies against this disease are limited. The heterogeneity of HGSOC, including few shared oncogenic drivers and origination from both the fallopian
Dima Ghannam-Shahbari et al.
Oncogene, 37(17), 2213-2224 (2018-01-31)
High grade serous carcinoma (HGSC) is the most common subtype of ovarian cancer and it is now widely accepted that this disease often originates from the fallopian tube epithelium. PAX8 is a fallopian tube lineage marker with an essential role
Amata Amy Soriano et al.
Cancer cell international, 19, 303-303 (2019-12-14)
Ovarian cancer is the third most common cause of death among gynecologic malignancies worldwide. Understanding the biology and molecular pathogenesis of ovarian epithelial tumors is key to developing improved prognostic indicators and effective therapies. We aimed to determine the effects

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service