Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGAGCACCTCAAACTTCAACTCCAGAAGGAATCCCTAAATGAGCTGAGGAAGGAGTGCACTGCAAAAAGAGAACTCTTCTTGAAGACTAATGCTCAGTTGACAATTCGTTGCAGGCAGTTACTCTCTGAGCTTTCCTACATTTACCCTATTGATTTGAATGAACATAAGGATTACTTTGTATGCGGTGTCAAGTTGCCTAATTCTGAGGACTTCCAAGCAAAAGATGATGGAAGCATTGCTGTTGCCCTTGGTTATACTGCACATCTGGTCTCCATGATTTCCTTTTTCCTACAAGTGCCCCTCAGATATCCTATAATTCATAAGGGGTCTAGATCAACAATCAAAGACAATATCAATGACAAACTGACGGAAAAGGAGAGAGAGTTTCCACTGTATCCAAAAGGAGGGGAGAAGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... UVRAG(7405)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Haoyuan Deng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 41(6), 2171-2182 (2017-04-26)
Atherosclerosis is a multifactorial chronic disease and is the main cause of death and impairment in the world. Endothelial injury and apoptosis play a crucial role in the onset and development of atherosclerosis. MicroRNAs (miRNAs) have been proven to be
Jianwen Wang et al.
OncoTargets and therapy, 13, 10275-10285 (2020-10-30)
Radiotherapy is one of the most important methods in the treatment of patients with hypopharyngeal squamous cell carcinoma (HSCC). However, radioresistance will be developed after repeated irradiation. Among many key factors contributing to radioresistance, enhanced autophagy is recognized as one
Yunha Kim et al.
Autophagy, 11(5), 796-811 (2015-05-07)
The EWSR1 (EWS RNA-binding protein 1/Ewing Sarcoma Break Point Region 1) gene encodes a RNA/DNA binding protein that is ubiquitously expressed and involved in various cellular processes. EWSR1 deficiency leads to impairment of development and accelerated senescence but the mechanism
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU061641-50UG | 04061828328055 |
| EHU061641-20UG | 04061828563647 |