Skip to Content
Merck
CN

EHU061701

MISSION® esiRNA

targeting human TNFSF11

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCAAGGAGCTGTGCAAAAGGAATTACAACATATCGTTGGATCACAGCACATCAGAGCAGAGAAAGCGATGGTGGATGGCTCATGGTTAGATCTGGCCAAGAGGAGCAAGCTTGAAGCTCAGCCTTTTGCTCATCTCACTATTAATGCCACCGACATCCCATCTGGTTCCCATAAAGTGAGTCTGTCCTCTTGGTACCATGATCGGGGTTGGGCCAAGATCTCCAACATGACTTTTAGCAATGGAAAACTAATAGTTAATCAGGATGGCTTTTATTACCTGTATGCCAACATTTGCTTTCGACATCATGAAACTTCAGGAGACCTAGCTACAGAGTATCTTCAACTAATGGTGTACGTCACTAAAACCAGCATCAAAATCCCAAGTTCTCATACCCTGATGAAAGGAGGAAGCACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Aase Haj Hensvold et al.
Arthritis research & therapy, 17, 239-239 (2015-09-05)
Receptor activator of nuclear factor kappa B ligand (RANKL) is a key regulator of bone metabolism. Anti-citrullinated protein antibodies (ACPA) have been suggested to cause bone destruction by osteoclast activation. We investigated the relationship between RANKL and ACPA in patients
Hae-Rim Kim et al.
PloS one, 10(4), e0124909-e0124909 (2015-04-22)
Vascular endothelial growth factor (VEGF) has angiogenic, inflammatory, and bone-destructive roles in rheumatoid arthritis (RA). We aimed to determine the unique role of VEGF in osteoclastogenesis in RA. VEGF-induced receptor activator of nuclear factor ҡB ligand (RANKL) expression was determined
Hong Hu et al.
Breast cancer research and treatment, 146(3), 515-523 (2014-07-11)
The receptor activator of nuclear factor-κB ligand (RANKL) acts as a paracrine factor in progesterone-induced mammary epithelial proliferation and tumorigenesis. This evidence comes mainly from mouse models. Our aim was to examine whether RANKL expression in human normal and malignant

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service