Skip to Content
Merck
CN

EHU061751

Sigma-Aldrich

MISSION® esiRNA

targeting human NEO1

Sign Into View Organizational & Contract Pricing

Select a Size

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

Key Documents

View All Documentation
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTGCATTCCAAACACAATAAACCTGATGAAGGTTATTATCAGTGTGTGGCCACTGTTGAGAGTCTTGGAACTATTATCAGTAGAACAGCGAAGCTCATAGTAGCAGGTCTTCCAAGATTTACCAGCCAACCAGAACCTTCCTCAGTTTATGCTGGGAACAATGCAATTCTGAATTGTGAAGTTAATGCAGATTTGGTCCCATTTGTGAGGTGGGAACAGAACAGACAACCCCTTCTTCTGGATGATAGAGTTATCAAACTTCCAAGTGGAATGCTGGTTATCAGCAATGCAACTGAAGGAGATGGCGGGCTTTATCGCTGCGTAGTGGAAAGTGGTGGGCCACCAAAGTATAGTGATGAAGTTGAATTGAAGGTTCTTCCAGATCCTGAGGTGATATCAGACTTGGTATTTTTGAAACAGCCTTCTCCCTTAGTCAGAGTCATTGGTCAGGATGTAGTGTTGCCATGTGTTGCTTC

Ensembl | human accession no.

ENSG00000067141

NCBI accession no.

NM_002499

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NEO1(4756), NEO1(4756)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
KFS

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Esma Lejmi et al.
Vascular cell, 6(1), 1-1 (2014-01-30)
Netrins are secreted molecules involved in axon guidance and angiogenesis. We previously showed that Netrin-4 acts as an anti-angiogenic factor by inhibiting endothelial cell (EC) functions. In this study, we investigated the effects of Netrin-4 on vascular smooth muscle cell
Vishal Chaturvedi et al.
Scientific reports, 9(1), 4110-4110 (2019-03-13)
Neogenin1 (NEO1) is a receptor of the Deleted in Colorectal Carcinoma (DCC)/Frazzled/UNC-40 family, which regulates axon guidance but can also stabilize epithelial adherens junctions. NEO1 and DCC are also tumor suppressors that can inhibit metastasis by acting as dependence receptors.
Céline Delloye-Bourgeois et al.
The Journal of experimental medicine, 206(4), 833-847 (2009-04-08)
Neuroblastoma (NB), the most frequent solid tumor of early childhood, is diagnosed as a disseminated disease in >60% of cases, and several lines of evidence support the resistance to apoptosis as a prerequisite for NB progression. We show that autocrine
Mari Kitayama et al.
PloS one, 6(9), e25234-e25234 (2011-10-01)
By causing damage to neural networks, spinal cord injuries (SCI) often result in severe motor and sensory dysfunction. Functional recovery requires axonal regrowth and regeneration of neural network, processes that are quite limited in the adult central nervous system (CNS).
Qingsong Zhang et al.
Oncology reports, 34(1), 258-264 (2015-05-23)
Neogenin has been documented as playing an important role in cancer development. Although an elevated expression of neogenin has been detected in human breast cancer, the role of neogenin in breast cancer cells is not clearly understood. In the present

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service