Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCCAGGAGGCCACTGAGGCGGCTCCCAGCTGCGTTGGCGACATGGCCGACACCCCCAGAGATGCCGGGCTCAAGCAGGCGCCTGCATCACGGAACGAGAAGGCCCCGGTGGACTTCGGCTACGTGGGGATTGACTCCATCCTGGAGCAGATGCGCCGGAAGGCCATGAAGCAGGGCTTCGAGTTCAACATCATGGTGGTCGGGCAGAGCGGCTTGGGTAAATCCACCTTAATCAACACCCTCTTCAAATCCAAAATCAGCCGGAAGTCGGTGCAGCCCACCTCAGAGGAGCGCATCCCCAAGACCATCGAGATCAAGTCCATCACGCACGATATTGAGGAGAAAGGCGTCCGGATGAAGCTGACAGTGATTGACACACCAGGGTTCGGGGACCACATCAACAACGAGAACTGCTGG
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SEPT9(10801)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Beatrice Stubendorff et al.
Journal of cancer research and clinical oncology, 145(4), 811-820 (2019-01-04)
In this study, we aimed to identify a DNA methylation pattern suitable for prognosis assessment of muscle-invasive bladder cancer and to investigate metastasis-associated processes regulated by DNA methylation. Genome-wide methylation analysis was performed on 23 muscle-invasive bladder tumors by microarray
Forooz Soroor et al.
Molecular biology of the cell, 32(3), 289-300 (2020-12-03)
Septins are conserved GTP-binding cytoskeletal proteins that polymerize into filaments by end-to-end joining of hetero-oligomeric complexes. In human cells, both hexamers and octamers exist, and crystallography studies predicted the order of the hexamers to be SEPT7-SEPT6-SEPT2-SEPT2-SEPT6-SEPT7, while octamers are thought
Guodong Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 125, 109768-109768 (2020-02-29)
Malignant glioma is a highly aggressive cancer, known as one of the most dangerous types of primary brain tumor occurring in the central nervous system (CNS). Septin 9 (SEPT9) has been involved in tumor growth. However, its exact roles in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU062441-50UG | 04061828380244 |
| EHU062441-20UG | 04061828605491 |