Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCAAAGTCACTTCCCCAAGATCTGCCAGACCTGCATGGTCAAGCCTCTTATGGGGGTGTTTCTATCTCTTTCTTTCTCTTTCTGTTTCCTGGCCTCAGAGCTTCCTGGGGACCAAGATTTACCAATTCACCCACTCCCTTGAAGTTGTGGAGGAGGTGAAAGAAAGGGACCCACCTGCTAGTCGCCCCTCAGAGCATGATGGGAGGTGTGCCAGAAAGTCCCCCCTCGCCCCAAAGTTGCTCACCGACTCACCTGCGCAAGTGCCTGGGATTCTACCGTAATTGCTTTGTGCCTTTGGGCACGGCCCTCCTTCTTTTCCTAACATGCACCTTGCTCCCAATGGTGCTTGGAGGGGGAAGAGATCCCAGGAGGTGCAGTGGAGGGGGCAAGCTTTGCTCCTTCAGTTCTGCTTGCTCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... AQP1(358)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Qiang Zhang et al.
Journal of receptor and signal transduction research, 39(2), 146-153 (2019-07-18)
To investigate the effect of miR-223 on thyroid cancer cells, further to study its potential mechanisms. The difference in miR-223 expression between normal thyroid Nthy-ori3-l cells and thyroid cancer SW579 cells was detected by PCR. The miR-223 overexpression and silencing
Hilary S Dorward et al.
Journal of experimental & clinical cancer research : CR, 35, 36-36 (2016-02-26)
Aquaporins (AQP) are water channel proteins that enable fluid fluxes across cell membranes, important for homeostasis of the tissue environment and for cell migration. AQP1 knockout mouse models of human cancers showed marked inhibition of tumor-induced angiogenesis, and in pre-clinical
Hui Luo et al.
Cell and tissue research, 381(3), 543-554 (2020-06-17)
To explore the effects of aquaporin (AQP) 1 on pregnancy outcome and the association between expression of AQP1 and other AQPs in the placenta and foetal membranes, the rate of copulatory plugs and pregnancy, amniotic fluid (AF) volume, osmolality and
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU062641-20UG | 04061831351095 |
| EHU062641-50UG | 04061828380435 |