Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGTGACACGCATCTTTTTGATAAGGTCAGAGGCTATGACATCAAGCTGCTTCGATACCTGTCAGTCAAATACATCTGTGACCTGATGGTGGAGAACAAGAAGGTGAAGTTTGGCATGAATGTAACCTCCTCTGAGAAGGTGGACAAAGCCCAGCGCTATGCCGACTTCACTCTCCTCTCCATCCCGTATCCAGGCTGTGAATTTTTCAAGGAATATAAAGATCGGGATTACATGGCAGAAGGGCTCATATTTAACTGGAAGCAGGACTACGTTGATGCCCCATTGAGCATCCCCGACTTCCTGACTCACTCTCTGAACATTGACTGGAGCCAGTATCAGTGTTGGGATCTGGTGCAACAAACACAAAACTACCTGAAGCTGCTGCTTTCCTTAGTTAACAGTGATGATGACAGCGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MTMR14(64419)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Zhaodong Li et al.
Gene, 691, 106-113 (2018-12-27)
Myotubularin-related protein 14 (MTMR14) is a member of the myotubularin (MTM)-related protein family and plays a key role in cardiomyopathy and autophagy. However, its potential implication in human cancer is unclear. In this study, we have investigated the expression profile
Qichen Pan et al.
Biochemical and biophysical research communications, 529(4), 1045-1052 (2020-08-21)
The phosphoinositide phosphatase, myotubularinrelated protein 14 (MTMR14), plays a critical role in the regulating autophagy. However, its functional contribution to neuronal autophagy is still unclear. In the present study, we attempted to explore the effects of MTMR14 on ischemic stroke
Jie-Lei Zhang et al.
Cell death & disease, 11(2), 140-140 (2020-02-23)
Cardiac hypertrophy (CH) is an independent risk factor for many cardiovascular diseases, and is one of the primary causes of morbidity and mortality in elderly people. Pathological CH involves excessive protein synthesis, increased cardiomyocyte size, and ultimately the development of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU064451-20UG | 04061828607198 |
| EHU064451-50UG | 04061828382118 |