Skip to Content
Merck
CN

EHU066241

MISSION® esiRNA

targeting human NDRG2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human NDRG2

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGGAAAAAGGGCAGATCATGCGGGGAGATGACCTTGATCTTTGATTGCTACCCTAACCTTGACCTTTAACCCGTGATTCCCCCCAGCTCCTGGAAGAGATGTCCTAATATCTCTTAGGGACCCAGACCCCTAAATTCTCCTCCTCCCCCATTTTGATGTTAAGGTGGAGAGGGCATATGCATCCTCTGTCCTGATCTAGGTGTCTATAGCTGAGGGGTAAGAGGTTGTTGTAGTTGTCCTGGTGCCTCCATCAGACTCTCCCTACTTGTCCCATATTTGCAAGGGGAGGGGATTTGGGGCTGGGGCTCCATTCACCAAAGCTGAGGTGGCTTCTCATTAACCCTTTAGGACTCTGAAGGGTATGGACCTACGTGAATGTGTGTCAGGGGGAGACTTGCTGGTGGGTTAGTGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

常规特殊物品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Z H Su et al.
Neoplasma, 67(5), 1002-1011 (2020-05-27)
Renal cell carcinoma (RCC) is the most common malignant tumor of the kidney. In this study, we investigated the role of miR-346 in RCC cells under hypoxia. OS-RC-2 and 786-O cells were cultured in 1% O2 or normal oxygen. Cell
Fenhong Kang et al.
Journal of ovarian research, 13(1), 48-48 (2020-04-30)
The cancer cell metastasis and the acquisition of chemotherapy resistance remain huge challenge for ovarian cancer treatment. Previously, N-myc downstream-regulated gene 2 (NDRG2) serves as a tumor suppressor for many cancers. Here, we attempted to investigate the specific roles of
A Das et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 22(7), 1138-1145 (2019-11-17)
N-myc downstream-regulated gene 2 (NDRG2) is down-regulated in grade-III meningioma [anaplastic meningioma (AM)] and associated with clinically aggressive behavior. Current therapies in the treatment of high-grade meningioma are lacking with limited success. This study aims to validate the effect of
Kyeongah Kang et al.
Biochemical and biophysical research communications, 468(4), 611-616 (2015-11-08)
N-Myc downstream-regulated gene 2 (NDRG2), a member of the NDRG family of differentiation-related genes, has been characterized as a regulator of dendritic cell differentiation from monocytes, CD34(+) progenitor cells, and myelomonocytic leukemic cells. In this study, we show that NDRG2
Xinyu Deng et al.
Oncotarget, 8(24), 38294-38308 (2017-04-19)
Breast cancer (BC) is a leading cause of cancer-related death in women. Adjuvant systemic chemotherapies are effective in reducing risks of recurrence and have contributed to reduced BC mortality. Although targeted adjuvant treatments determined by biomarkers for endocrine and HER2-directed

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service