Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCCATTGTAACCAGGTCATCAGAGGACCATTCTTAGTGGCACTGGGGAAATCTTGGCACCCAGAAGAATTCAACTGCGCTCACTGCAAAAATACAATGGCCTACATTGGATTTGTAGAGGAGAAAGGAGCCCTGTATTGTGAGCTGTGCTATGAGAAATTCTTTGCCCCTGAATGTGGTCGATGCCAAAGGAAGATCCTTGGAGAAGTCATCAGTGCGTTGAAACAAACTTGGCATGTTTCCTGTTTTGTGTGTGTAGCCTGTGGAAAGCCCATTCGGAACAATGTTTTTCACTTGGAGGATGGTGAACCCTACTGTGAGACTGATTATTATGCCCTCTTTGGTACTATATGCCATGGATGTGAATTTCCCATAGAAGCTGGTGACATGTTCCTGGAAGCTCTGGGCTACAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PDLIM5(10611)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Han Cheng et al.
Journal of biomolecular screening, 21(4), 333-341 (2016-01-15)
Pulmonary arterial hypertension is a complex disease with multiple etiologic factors. PDLIM5, a member of the Enigma subfamily of PDZ and LIM domain protein family, contains an N-terminal PDZ domain and three LIM domains at its C-terminus. We have previously
Xiaodan Wei et al.
Biochemical and biophysical research communications, 499(2), 338-344 (2018-03-27)
In order to better understand the mechanisms underlying the development of papillary thyroid carcinoma (PTC), and to identify new potential biomarkers, high-resolution label-free mass spectrometry was performed on PTC tissues and adjacent normal thyroid tissues from six patients. In this
Yong Lu et al.
Psychoneuroendocrinology, 115, 104629-104629 (2020-03-17)
Prenatal stress (PS) contributes to depression-like behavior in the offspring. PDLIM5 is involved in the onset of mental disorders. This study is to investigate the role and mechanism of PDLIM5 in depression-like behavior of PS offspring rats. PS model was
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU067781-50UG | 04061828385232 |
| EHU067781-20UG | 04061828608027 |