Skip to Content
Merck
CN

EHU067991

MISSION® esiRNA

targeting human CNKSR1

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGACACACGCTCTACTGGTACCGCCAGCCCCAGGATGAGAAGGCTGAGGGCCTCATCAATGTCTCCAACTATAGTCTGGAAAGTGGACATGATCAGAAGAAGAAATATGTGTTTCAGCTCACCCATGATGTGTACAAACCCTTCATCTTCGCTGCTGATACCCTGACAGATCTGAGCATGTGGGTGCGTCATCTCATTACCTGCATCTCCAAGTACCAGTCTCCAGGCCGGGCCCCCCCACCCCGAGAGGAAGACTGCTACAGTGAGACCGAAGCAGAGGACCCGGACGATGAGGCTGGGTCCCACTCAGCCTCGCCCAGCCCTGCTCAAGCTGGGAGTCCCCTCCATGGAGACACATCACCTGCAGCCACCCCCACACAGCGCAGCCCACGGACCTCCTTTGGCTCTCTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Adrian Fischer et al.
Scientific reports, 6, 38155-38155 (2016-12-03)
Scaffold proteins such as the multidomain protein CNK1 orchestrate the signalling network by integrating and controlling the underlying pathways. Using an optogenetic approach to stimulate CNK1 uncoupled from upstream effectors, we identified selective clusters of CNK1 that either stimulate RAF-MEK-ERK
Martin Indarte et al.
Cancer research, 79(12), 3100-3111 (2019-05-02)
Cnk1 (connector enhancer of kinase suppressor of Ras 1) is a pleckstrin homology (PH) domain-containing scaffold protein that increases the efficiency of Ras signaling pathways, imparting efficiency and specificity to the response of cell proliferation, survival, and migration. Mutated KRAS

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service