Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCCTCTGGCCTCTAGGTAACCAGTTTAAATTGGTTCAGGGTGATAACTACTTAGCACTGCCCTGGTGATTACCCAGAGATATCTATGAAAACCAGTGGCTTCCATCAAACCTTTGCCAACTCAGGTTCACAGCAGCTTTGGGCAGTTATGGCAGTATGGCATTAGCTGAGAGGTGTCTGCCACTTCTGGGTCAATGGAATAATAAATTAAGTACAGGCAGGAATTTGGTTGGGAGCATCTTGTATGATCTCCGTATGATGTGATATTGATGGAGATAGTGGTCCTCATTCTTGGGGGTTGCCATTCCCACATTCCCCCTTCAACAAACAGTGTAACAGGTCCTTCCCAGATTTAGGGTACTTTTATTGATGGATATGTTTTCCTTTTATTCACATAACCCCTTGAAACCCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CD47(961)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xifu Song et al.
Experimental and therapeutic medicine, 20(4), 3301-3309 (2020-08-29)
Treatment with cluster of differentiation 47 (CD47) monoclonal antibody has exhibited promising antitumor effects in various preclinical cancer models. However, its role in pancreatic ductal adenocarcinoma (PDAC) remains unclear. In the present study, the CD47 expression level was measured in
Xuejian Liu et al.
Oncology research, 27(4), 415-422 (2018-01-13)
Cluster of differentiation 47 (CD47) overexpression is common in various malignancies. This study investigated whether CD47 promotes human glioblastoma invasion and, if so, the underlying mechanisms involved. CD47 expression was found to be stronger in tissues of patients with glioblastoma
Natasha M Rogers et al.
Kidney international, 90(2), 334-347 (2016-06-05)
Defects in renal tubular epithelial cell repair contribute to renal ischemia reperfusion injury, cause acute kidney damage, and promote chronic renal disease. The matricellular protein thrombospondin-1 and its receptor CD47 are involved in experimental renal ischemia reperfusion injury, although the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU068161-20UG | 04061828608287 |
| EHU068161-50UG | 04061828369935 |