Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCCCTTTCTGTCCCACTACATCTGGGACTGACTTTCCGAGCCTCCAGTCCAAAGCCGGCTTGATTTCCGTGAACTCTGGTGCTCCTGCATCTCATGAGTGTGCCCCATGGGTCCCCTCCCCTCTCAGCATTTCCTTGTCCCGTCTGGACCTGGGGAGTGGTTAGGCAGCAAGCTTTGGTTTATGGTTTTCATTCATTGGTGAAGTAAATTAGGCAGTGCTAAAGCCTGTGGGTTTGGTCCTTGAACAAGATGTGGGCCTTGCAAGATGGGAGAGTAAACCTTGAAGGGCTTTATTAAAGAAATAAAAAAGAACTTTTGTATCTTTTATCCTGGGAGCACTGCGTTTTCCTAGCTGTGTTATTCCTGGTTTAATTCAGCAGAGAAGGTAAGGTGTGAACCTACCTGCCTTGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... AMFR(267)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Youngah Jo et al.
Molecular biology of the cell, 24(3), 169-183 (2012-12-12)
Sterol-induced binding to Insigs in endoplasmic reticulum (ER) membranes triggers ubiquitination of the cholesterol biosynthetic enzyme 3-hydroxy-3-methylglutaryl CoA reductase. This ubiquitination, which is mediated by Insig-associated ubiquitin ligases gp78 and Trc8, is obligatory for extraction of reductase from lipid droplet-associated
Ming Zong et al.
Arthritis research & therapy, 17, 100-100 (2015-04-19)
Fibroblast-like synoviocytes (FLS) play an important role in the pathogenesis of rheumatoid arthritis (RA). This study aimed to investigate the role of glucose 6-phosphate isomerase (GPI) in the proliferation of RA-FLS. The distribution of GPI in synovial tissues from RA
Jin Chai et al.
Journal of hepatology, 63(6), 1440-1448 (2015-07-28)
Multidrug resistance-associated protein 2 (MRP2) excretes conjugated organic anions including bilirubin and bile acids. Malfunction of MRP2 leads to jaundice in patients. Studies in rodents indicate that Radixin plays a critical role in determining Mrp2 canalicular membrane expression. However, it
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU068841-20UG | 04061831352061 |
| EHU068841-50UG | 04061828385546 |