Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAGACATCAAGCAGGAAGGGGTCGGTGCATTTCGAGAGGGGCCGCCCTACCAGCGCCGGGGTGCCCTGCAGCTGTGGCAATTTCTGGTGGCCTTGCTGGATGACCCAACAAATGCCCATTTCATTGCCTGGACGGGCCGGGGAATGGAGTTCAAGCTCATTGAGCCTGAGGAGGTCGCCAGGCTCTGGGGCATCCAGAAGAACCGGCCAGCCATGAATTACGACAAGCTGAGCCGCTCGCTCCGATACTATTATGAGAAAGGCATCATGCAGAAGGTGGCTGGTGAGCGTTACGTGTACAAGTTTGTGTGTGAGCCCGAGGCCCTCTTCTCTTTGGCCTTCCCGGACAATCAGCGTCCAGCTCTCAAGGCTGAGTTTGACCGGCCTGTCAGTGAGGAGGACACAGTCCCTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ETV4(2118)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Irene Cosi et al.
Journal of hematology & oncology, 13(1), 112-112 (2020-08-15)
ETV4 is one of the ETS proteins overexpressed in prostate cancer (PC) as a result of recurrent chromosomal translocations. In human prostate cell lines, ETV4 promotes migration, invasion, and proliferation; however, its role in PC has been unclear. In this
Jeon-Soo Lee et al.
Cancer cell international, 20, 42-42 (2020-02-12)
Although major driver gene mutations have been identified, the complex molecular heterogeneity of colorectal cancer (CRC) remains unclear. Capicua (CIC) functions as a tumor suppressor in various types of cancers; however, its role in CRC progression has not been examined.
Yin Leng et al.
Cancer cell international, 21(1), 17-17 (2021-01-08)
Recent studies have reported the involvement of microRNA-29 (miR-29) family members in human cancers through their ability to regulate cellular functions. The present study investigated biological function of miR-29b in colorectal cancer (CRC). CRC tissues and adjacent normal tissues were
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU069441-20UG | 04061831352184 |
| EHU069441-50UG | 04061831372557 |