Skip to Content
Merck
CN

EHU069441

Sigma-Aldrich

MISSION® esiRNA

targeting human ETV4

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGACATCAAGCAGGAAGGGGTCGGTGCATTTCGAGAGGGGCCGCCCTACCAGCGCCGGGGTGCCCTGCAGCTGTGGCAATTTCTGGTGGCCTTGCTGGATGACCCAACAAATGCCCATTTCATTGCCTGGACGGGCCGGGGAATGGAGTTCAAGCTCATTGAGCCTGAGGAGGTCGCCAGGCTCTGGGGCATCCAGAAGAACCGGCCAGCCATGAATTACGACAAGCTGAGCCGCTCGCTCCGATACTATTATGAGAAAGGCATCATGCAGAAGGTGGCTGGTGAGCGTTACGTGTACAAGTTTGTGTGTGAGCCCGAGGCCCTCTTCTCTTTGGCCTTCCCGGACAATCAGCGTCCAGCTCTCAAGGCTGAGTTTGACCGGCCTGTCAGTGAGGAGGACACAGTCCCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Irene Cosi et al.
Journal of hematology & oncology, 13(1), 112-112 (2020-08-15)
ETV4 is one of the ETS proteins overexpressed in prostate cancer (PC) as a result of recurrent chromosomal translocations. In human prostate cell lines, ETV4 promotes migration, invasion, and proliferation; however, its role in PC has been unclear. In this
Jeon-Soo Lee et al.
Cancer cell international, 20, 42-42 (2020-02-12)
Although major driver gene mutations have been identified, the complex molecular heterogeneity of colorectal cancer (CRC) remains unclear. Capicua (CIC) functions as a tumor suppressor in various types of cancers; however, its role in CRC progression has not been examined.
Yin Leng et al.
Cancer cell international, 21(1), 17-17 (2021-01-08)
Recent studies have reported the involvement of microRNA-29 (miR-29) family members in human cancers through their ability to regulate cellular functions. The present study investigated biological function of miR-29b in colorectal cancer (CRC). CRC tissues and adjacent normal tissues were
Sung-Won Park et al.
Biochemical and biophysical research communications, 487(3), 532-538 (2017-04-17)
We demonstrated that ETV4 is a transcriptional activator of the NANOG gene in human embryonic carcinoma NCCIT cells. The endogenous expression of NANOG and ETV4 in naïve cells was significantly down-regulated upon differentiation and by shRNA-mediated knockdown of ETV4. NANOG

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service