Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCAACGGGACAAATCCTAGAGGGTATAAAATCATCTCTGCTCAGATAATCATGACTTAGCAAGAATAAGGGCAAAAAATCCTGTTGGCTTAACGTCACTGTTCCACCCGGTGTAATATCTCTCATGACAGTGACACCAAGGGAAGTTGACTAAGTCACATGTAAATTAGGAGTGTTTTAAAGAATGCCATAGATGTTGATTCTTAACTGCTACAGATAACCTGTAATTGAGCAGATTTAAAATTCAGGCATACTTTTCCATTTATCCAAGTGCTTTCATTTTTCCAGATGGCTTCAGAAGTAGGCTCGTGGGCAGGGCGCAGACCTGATCTTTATAGGGTTGACATAGAAAGCAGTAGTTGTGGGTGAAAGGGCAGGTTGTCTTCAAACTCTGTGAGGTAGAATCCTTTGTCTATACCTCCATGAACATTGACTCGTGTGTTCAGAGCCTTTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ADAR(103)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Eduardo A Sagredo et al.
Biochimica et biophysica acta. Molecular cell research, 1867(8), 118716-118716 (2020-04-11)
RNA editing has emerged as a novel mechanism in cancer progression. The double stranded RNA-specific adenosine deaminase (ADAR) modifies the expression of an important proportion of genes involved in cell cycle control, DNA damage response (DDR) and transcriptional processing, suggesting
ADAR2 Is Involved in Self and Nonself Recognition of Borna Disease Virus Genomic RNA in the Nucleus.
Mako Yanai et al.
Journal of virology, 94(6) (2019-12-20)
Cells sense pathogen-derived double-stranded RNA (dsRNA) as nonself. To avoid autoimmune activation by self dsRNA, cells utilize A-to-I editing by adenosine deaminase acting on RNA 1 (ADAR1) to disrupt dsRNA structures. Considering that viruses have evolved to exploit host machinery
Maria Pujantell et al.
Scientific reports, 9(1), 19848-19848 (2019-12-29)
Infection by human papillomavirus (HPV) alters the microenvironment of keratinocytes as a mechanism to evade the immune system. A-to-I editing by ADAR1 has been reported to regulate innate immunity in response to viral infections. Here, we evaluated the role of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU070911-20UG | 04061831352443 |
| EHU070911-50UG | 04061828370900 |