Skip to Content
Merck
CN

EHU070911

MISSION® esiRNA

targeting human ADAR

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human ADAR

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAACGGGACAAATCCTAGAGGGTATAAAATCATCTCTGCTCAGATAATCATGACTTAGCAAGAATAAGGGCAAAAAATCCTGTTGGCTTAACGTCACTGTTCCACCCGGTGTAATATCTCTCATGACAGTGACACCAAGGGAAGTTGACTAAGTCACATGTAAATTAGGAGTGTTTTAAAGAATGCCATAGATGTTGATTCTTAACTGCTACAGATAACCTGTAATTGAGCAGATTTAAAATTCAGGCATACTTTTCCATTTATCCAAGTGCTTTCATTTTTCCAGATGGCTTCAGAAGTAGGCTCGTGGGCAGGGCGCAGACCTGATCTTTATAGGGTTGACATAGAAAGCAGTAGTTGTGGGTGAAAGGGCAGGTTGTCTTCAAACTCTGTGAGGTAGAATCCTTTGTCTATACCTCCATGAACATTGACTCGTGTGTTCAGAGCCTTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... ADAR(103), ADAR(103)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eduardo A Sagredo et al.
Biochimica et biophysica acta. Molecular cell research, 1867(8), 118716-118716 (2020-04-11)
RNA editing has emerged as a novel mechanism in cancer progression. The double stranded RNA-specific adenosine deaminase (ADAR) modifies the expression of an important proportion of genes involved in cell cycle control, DNA damage response (DDR) and transcriptional processing, suggesting
Mako Yanai et al.
Journal of virology, 94(6) (2019-12-20)
Cells sense pathogen-derived double-stranded RNA (dsRNA) as nonself. To avoid autoimmune activation by self dsRNA, cells utilize A-to-I editing by adenosine deaminase acting on RNA 1 (ADAR1) to disrupt dsRNA structures. Considering that viruses have evolved to exploit host machinery
Maria Pujantell et al.
Scientific reports, 9(1), 19848-19848 (2019-12-29)
Infection by human papillomavirus (HPV) alters the microenvironment of keratinocytes as a mechanism to evade the immune system. A-to-I editing by ADAR1 has been reported to regulate innate immunity in response to viral infections. Here, we evaluated the role of
Yan Sun et al.
Cell death & disease, 11(6), 432-432 (2020-06-10)
Vascular remodeling can be caused by angiotensin II type 1 receptor (AT1R) autoantibody (AT1-AA), although the related mechanism remains unknown. Angiotensin II type 2 receptor (AT2R) plays multiple roles in vascular remodeling through cross-talk with AT1R in the cytoplasm. Here
Tatiana Altadill et al.
Scientific reports, 7(1), 8803-8803 (2017-08-20)
Endometrial cancer (EC) remains the most common malignancy of the genital tract among women in developed countries. Although much research has been performed at genomic, transcriptomic and proteomic level, there is still a significant gap in the metabolomic studies of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service