Skip to Content
Merck
CN

EHU071181

MISSION® esiRNA

targeting human PLCE1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGATTTCCTCGTGAATTGCCAAGGAGAACACTGCACTTATGATGAAATCCTCAGCATCATCCAGAAGTTCGAGCCTAGCATCAGTATGTGTCATCAGGGACTAATGTCATTTGAAGGGTTTGCCAGGTTTCTGATGGATAAAGAAAATTTTGCCTCAAAAAATGATGAGTCACAGGAGAACATTAAAGAACTGCAGCTACCCCTCTCATACTATTACATCGAATCTTCGCACAATACCTACCTCACGGGCCATCAGCTCAAAGGAGAATCCTCGGTAGAACTCTACAGCCAGGTCCTTTTGCAAGGCTGTCGAAGTGTAGAATTGGACTGCTGGGACGGAGACGATGGGATGCCCATCATTTATCATGGACATACGCTGACAACCAAGATCCCCTTCAAGGAAGTGGTTGAAGCCATTGATCGCAGTGCCTTCATCAACTCTGACCTGCCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chun Tang et al.
Journal of cellular biochemistry, 120(6), 10678-10687 (2019-01-18)
Esophageal squamous cell carcinoma (ESCC) is the leading pathologic type in China. miR-145 has been reported to be downregulated in multiple tumors. This study was aimed to investigate the role of miR-145 in ESCC. miR-145 expression was investigated in 65
Xiaobin Cui et al.
Molecular and cellular biochemistry, 442(1-2), 111-127 (2017-12-15)
Phospholipase C epsilon 1 (PLCE1) has been recognized as a novel susceptibility marker for esophageal squamous cell carcinoma (ESCC). The purpose of our study is to investigate its effect on the regulation of miRNA expression so as to translating the
Xiao-Bin Cui et al.
Oncotarget, 8(54), 92454-92469 (2017-12-02)
Esophageal squamous cell carcinoma (ESCC) is one of the frequent malignant tumors with poor prognosis worldwide. Identifying the prognostic biomarkers and potential mechanisms of such tumors has attracted increasing interest in esophageal cancer biology. Our previous study showed that phospholipase
Yunzhao Chen et al.
Cancer research, 80(11), 2175-2189 (2020-02-19)
Esophageal squamous cell carcinoma (ESCC) is one of the deadliest malignant diseases. Multiple studies with large clinic-based cohorts have revealed that variations of phospholipase C epsilon 1 (PLCE1) correlate with esophageal cancer susceptibility. However, the causative role of PLCE1 in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service