Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACGATTTCCTCGTGAATTGCCAAGGAGAACACTGCACTTATGATGAAATCCTCAGCATCATCCAGAAGTTCGAGCCTAGCATCAGTATGTGTCATCAGGGACTAATGTCATTTGAAGGGTTTGCCAGGTTTCTGATGGATAAAGAAAATTTTGCCTCAAAAAATGATGAGTCACAGGAGAACATTAAAGAACTGCAGCTACCCCTCTCATACTATTACATCGAATCTTCGCACAATACCTACCTCACGGGCCATCAGCTCAAAGGAGAATCCTCGGTAGAACTCTACAGCCAGGTCCTTTTGCAAGGCTGTCGAAGTGTAGAATTGGACTGCTGGGACGGAGACGATGGGATGCCCATCATTTATCATGGACATACGCTGACAACCAAGATCCCCTTCAAGGAAGTGGTTGAAGCCATTGATCGCAGTGCCTTCATCAACTCTGACCTGCCAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PLCE1(51196)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chun Tang et al.
Journal of cellular biochemistry, 120(6), 10678-10687 (2019-01-18)
Esophageal squamous cell carcinoma (ESCC) is the leading pathologic type in China. miR-145 has been reported to be downregulated in multiple tumors. This study was aimed to investigate the role of miR-145 in ESCC. miR-145 expression was investigated in 65
Xiaobin Cui et al.
Molecular and cellular biochemistry, 442(1-2), 111-127 (2017-12-15)
Phospholipase C epsilon 1 (PLCE1) has been recognized as a novel susceptibility marker for esophageal squamous cell carcinoma (ESCC). The purpose of our study is to investigate its effect on the regulation of miRNA expression so as to translating the
Yunzhao Chen et al.
Cancer research, 80(11), 2175-2189 (2020-02-19)
Esophageal squamous cell carcinoma (ESCC) is one of the deadliest malignant diseases. Multiple studies with large clinic-based cohorts have revealed that variations of phospholipase C epsilon 1 (PLCE1) correlate with esophageal cancer susceptibility. However, the causative role of PLCE1 in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU071181-50UG | 04061828371150 |
| EHU071181-20UG | 04061831352481 |