Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACAGCAATGAGTCGGATGTGGTCGAGAGCCTGGATGAAATCTACCACACGGGGACGTTTGCCCAGATCCATGAGATGCAGGACCTTGGGGACAAGCTGCGCATGATCGTCATGGGACACAGAAGAGTCCATATCAGCAGACAGCTGGAGGTGGAGCCCGAGGAGCCGGAGGCGGAGAACAAGCACAAGCCCCGCAGGAAGTCAAAGCGGGGCAAGAAGGAGGCGGAGGACGAGCTGAGCGCCAGGCACCCGGCGGAGCTGGCGATGGAGCCCACCCCTGAGCTCCCGGCTGAGGTGCTCATGGTGGAGGTAGAGAACGTTGTCCACGAGGACTTCCAGGTCACGGAGGAGGTGAAAGCCCTGACTGCAGAGATCGTGAAGACCATCCGGGACATCATTGCCTTGAACCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... LONP1(9361)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Olga Zurita Rendón et al.
Molecular and cellular biology, 38(20) (2018-08-01)
LONP1, an AAA+ mitochondrial protease, is implicated in protein quality control, but its precise role in this process remains poorly understood. In this study, we have investigated the role of human LONP1 in mitochondrial proteostasis and gene expression. Depletion of
Shiyuan Huang et al.
American journal of physiology. Cell physiology, 319(6), C1020-C1028 (2020-09-17)
Myoblast differentiation is a crucial process for myogenesis. Mitochondria function as an energy-providing machine that is critical to this process, and mitochondrial dysfunction can prevent myoblasts from fusing into myotubes. However, the molecular mechanisms underlying the dynamic regulation of mitochondrial
Meng Zhao et al.
Theranostics, 11(4), 1845-1863 (2021-01-08)
Aims: Ischemia-reperfusion injury (IRI)-induced acute kidney injury (IRI-AKI) is characterized by elevated levels of reactive oxygen species (ROS), mitochondrial dysfunction, and inflammation, but the potential link among these features remains unclear. In this study, we aimed to investigate the specific
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU072201-20UG | 04061828611621 |
| EHU072201-50UG | 04061828372089 |