Skip to Content
Merck
CN

EHU072531

MISSION® esiRNA

targeting human HPGD

Sign In to View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACTCTTTGCAAGCAGTAATTAACACTAGTAACAGTGAAAGCACAAGATTTCCAAATCAGTCGTTTTCTCAAAAAAATATCGTATAAGTGACTCATCCTGTCTGCTAACTCCAGACCTCCCAGCTTGAAGCCAAATCTTTCCATGTGAGATTGATATGGATTTCCTAGAAGTACTGGAATGTTGTCATATCTTGCCCTATTTTAATTCTGCTATAGAAAACAATTGCCTTCACTTTTAAGGAGTAATTTGAATATTAATAACTCTGGTCTAGATTTTCATATAATGTATTAAAGACAAAGTAGTGAACATCAATGAACATCTGATAGAGATAAACTGTAATCAGGCATAAGCTTGTTTGTATGTTCTGGCAGTGACTAATCAGTAAATGATGTCGGTTTGCCCAGTAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lu Lu et al.
Molecular cancer research : MCR, 12(6), 890-900 (2014-04-05)
miRNAs are a group of small, noncoding RNAs that modulate the translation of genes by binding to specific target sites in the target mRNA. This study investigated the biologic function and molecular mechanism of miR-21 in human cholangiocarcinoma. In situ
Gyeoung-Jin Kang et al.
Biochimica et biophysica acta, 1852(9), 1981-1988 (2015-07-15)
High-mobility group box 1 (HMGB1) enhances inflammatory reactions by potentiating the activity of pro-inflammatory mediators and suppressing the phagocytosis of apoptotic neutrophils. However, the effects of HMGB1 on phagocytosis induced by pro-resolving mediators, such as resolvins, have not been studied

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service