Skip to Content
Merck
CN

EHU073141

MISSION® esiRNA

targeting human HERPUD1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCCTTTATGAGCACAGCATGGCTTGTCTTCAAGACTTTCTTTGCCTCTCTTCTTCCAGAAGGCCCCCCAGCCATCGCAAACTGATGGTGTTTGTGCTGTAGCTGTTGGAGGCTTTGACAGGAATGGACTGGATCACCTGACTCCAGCTAGATTGCCTCTCCTGGACATGGCAATGATGAGTTTTTAAAAAACAGTGTGGATGATGATATGCTTTTGTGAGCAAGCAAAAGCAGAAACGTGAAGCCGTGATACAAATTGGTGAACAAAAAATGCCCAAGGCTTCTCATGTCTTTATTCTGAAGAGCTTTAATATATACTCTATGTAGTTTAATAAGCACTGTACGTAGAAGGCCTTAGGTGTTGCATGTCTATGCTTGAGGAACTTTTCCAAATGTGTGTGTCTGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Huanhuan Luo et al.
Molecular neurobiology, 55(10), 7652-7668 (2018-02-13)
In neurodegenerative diseases, pathogenic proteins tend to misfold and form aggregates that are difficult to remove and able to induce excessive endoplasmic reticulum (ER) stress, leading to neuronal injury and apoptosis. Homocysteine-induced endoplasmic reticulum protein (Herp), an E3 ubiquitin ligase
Ainhoa Martínez-Pizarro et al.
PloS one, 11(3), e0150357-e0150357 (2016-03-10)
Proper function of endoplasmic reticulum (ER) and mitochondria is crucial for cellular homeostasis, and dysfunction at either site as well as perturbation of mitochondria-associated ER membranes (MAMs) have been linked to neurodegenerative and metabolic diseases. Previously, we have observed an
Tao Wang et al.
PLoS pathogens, 13(10), e1006674-e1006674 (2017-10-07)
Endoplasmic reticulum-associated degradation (ERAD) is an important function for cellular homeostasis. The mechanism of how picornavirus infection interferes with ERAD remains unclear. In this study, we demonstrated that enterovirus 71 (EV71) infection significantly inhibits cellular ERAD by targeting multiple key

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service