Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGTGAGCTGCTGGAAGTGAACAAGCAGTGGGACCAGCATTTCCGGTCCATGAAGCAGCAGTATGAGCAGAAGATCACTGAGCTGCGTCAGAAGCTGGCTGATTTGCAGAAGCAGGTGACTGACCTGGAGGCCGAGCGGGAGCAGAAGCAGCGTGACTTTGACCGCAAGCTCCTCCTGGCCAAGTCCAAGATTGAAATGGAGGAGGCAAGTACCGACAAGGAGCAGCTGACAGCAGAGGCCAAGGAGCTGCGCCAAAAGGTCAAGTACCTGCAGGATCAGCTGAGCCCACTCACCCGACAGCGTGAGTACCAGGAAAAGGAGATCCAGCGGCTCAACAAGGCCCTGGAGGAAGCACTGAGCATCCAAACCCCGCCATCATCTCCACCAACAGCATTTGGGAGCCCAGAAGGAGCAGGGGCCCTCCTAAGGAAACAGGAGCTGGTCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TNIP1(10318)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Rambon Shamilov et al.
Mediators of inflammation, 2020, 5919150-5919150 (2020-05-08)
TNIP1 protein is a widely expressed, cytoplasmic inhibitor of inflammatory signaling initiated by membrane receptors such as TLRs which recognize pathogen-associated and damage-associated molecular patterns (PAMPs and DAMPs). Keratinocyte TNIP1 deficiency sensitizes cells to PAMPs and DAMPs promoting hyperresponsive expression
Ellen M Westerhout et al.
Nucleic acids research, 33(2), 796-804 (2005-02-03)
HIV-1 replication can be efficiently inhibited by intracellular expression of an siRNA targeting the viral RNA. However, HIV-1 escape variants emerged after prolonged culturing. These RNAi-resistant viruses contain nucleotide substitutions or deletions in or near the targeted sequence. We observed
Lilla Erdei et al.
Frontiers in immunology, 9, 2155-2155 (2018-10-16)
Human skin cells recognize the presence of the skin microbiome through pathogen recognition receptors. Epidermal keratinocytes are known to activate toll-like receptors (TLRs) 2 and 4 in response to the commensal Cutibacterium acnes (C. acnes, formerly known as Propionibacterium acnes)
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU075271-20UG | 04061828679034 |
| EHU075271-50UG | 04061828392070 |