Skip to Content
Merck
CN

EHU075291

Sigma-Aldrich

MISSION® esiRNA

targeting human VPS35

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTGAAGATGGACCTGGAATCCCAGCGGATATTAAACTTTTTGATATATTTTCACAGCAGGTGGCTACAGTGATACAGTCTAGACAAGACATGCCTTCAGAGGATGTTGTATCTTTACAAGTCTCTCTGATTAATCTTGCCATGAAATGTTACCCTGATCGTGTGGACTATGTTGATAAAGTTCTAGAAACAACAGTGGAGATATTCAATAAGCTCAACCTTGAACATATTGCTACCAGTAGTGCAGTTTCAAAGGAACTCACCAGACTTTTGAAAATACCAGTTGACACTTACAACAATATTTTAACAGTCTTGAAATTAAAACATTTTCACCCACTCTTTGAGTACTTTGACTACGAGTCCAGAAAGAGCATGAGTTGTTATGTGCTTAGTAATGTTCTGGATTATAACACAGAAATTGTCTCTCAAGACCAGGTGGATTCCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Peiqi Yin et al.
Cellular and molecular life sciences : CMLS, 73(4), 869-881 (2015-08-25)
Hepatitis C virus (HCV) has infected over 170 million people worldwide. Phosphatidylinositol 4-phosphate (PI4P) is the organelle-specific phosphoinositide enriched at sites of HCV replication. Whether retromer, a PI4P-related host transport machinery, unloads its cargo at HCV replication sites remains inconclusive.
Anna Ansell-Schultz et al.
Molecular and cellular neurosciences, 93, 18-26 (2018-09-27)
Alzheimer's disease (AD) is a neurodegenerative disorder characterized by a progressive loss of multiple cognitive functions. Accumulation of amyloid beta oligomers (oAβ) play a major role in the neurotoxicity associated with the disease process. One of the early affected brain
Amod Godbole et al.
Nature communications, 8(1), 443-443 (2017-09-07)
A new paradigm of G-protein-coupled receptor (GPCR) signaling at intracellular sites has recently emerged, but the underlying mechanisms and functional consequences are insufficiently understood. Here, we show that upon internalization in thyroid cells, endogenous TSH receptors traffic retrogradely to the
Prasad Tammineni et al.
Human molecular genetics, 26(22), 4352-4366 (2017-10-04)
Lysosomal proteolysis is essential for the quality control of intracellular components and the maintenance of cellular homeostasis. Lysosomal alterations have been implicated as one of the main cellular defects contributing to the onset and progression of Alzheimer's disease (AD). However
Santanu Das et al.
Journal of cell science, 133(24) (2020-12-04)
The Wilson disease protein, ATP7B maintains copper (herein referring to the Cu+ ion) homeostasis in the liver. ATP7B traffics from trans-Golgi network to endolysosomes to export excess copper. Regulation of ATP7B trafficking to and from endolysosomes is not well understood.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service