Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGTTGGTGAGCCTGACTCTAGGGTTCTAGCCCACATAAGAGATGATGATGTTATAATCAGAATCAACACAGATGGGGCCGAATATAACATAGAGCCACTTTGGAGATTTGTTAATGATACCAAAGACAAAAGAATGTTAGTTTATAAATCTGAAGATATCAAGAATGTTTCACGTTTGCAGTCTCCAAAAGTGTGTGGTTATTTAAAAGTGGATAATGAAGAGTTGCTCCCAAAAGGGTTAGTAGACAGAGAACCACCTGAAGAGCTTGTTCATCGAGTGAAAAGAAGAGCTGACCCAGATCCCATGAAGAACACGTGTAAATTATTGGTGGTAGCAGATCATCGCTTCTACAGATACATGGGCAGAGGGGAAGAGAGTACAACTACAAATTACTTAATAGAGCTAATTGACAGAGTTGATGACATCTATCGGAACACTTCATGGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ADAM17(6868)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jacob J Orme et al.
Oncoimmunology, 9(1), 1744980-1744980 (2020-05-05)
ADAM10 and ADAM17 expression and soluble PD-L1 (sPD-L1) predict poor prognosis in many malignancies, including in patients treated with PD-(L)1 inhibitors. The mechanism of soluble PD-L1 production and its effects are unknown. Here we uncover a novel mechanism of ADAM10-
Junsuke Uwada et al.
Cellular signalling, 35, 188-196 (2017-04-17)
Intestinal epithelial cells form a tight barrier to act as selective physical barriers, repelling hostile substances. Tumor necrosis factor-α (TNF-α) is a well characterized pro-inflammatory cytokine which can compromise intestinal barrier function and the suppression of TNF-α function is important
ADAM17 promotes epithelial-mesenchymal transition via TGF-β/Smad pathway in gastric carcinoma cells.
Min Xu et al.
International journal of oncology, 49(6), 2520-2528 (2016-10-26)
Although a disintegrin and metalloproteinase-17 (ADAM17) overexpression has been demonstrated in numerous human tumors including gastric cancer, its role in gastric cancer development remains to be clarified. In the present study, we identify that ADAM17 activates TGF-β/Smad signaling to promote
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU075381-20UG | 04061831353174 |
| EHU075381-50UG | 04061828392179 |