Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAAGGCATTGGTGAAGACAAAATGGCCTCGCCGGCTGACAGCTGTATCCAGTTCACCCGCCATGCCAGTGATGTTCTTCTCAACCTTAATCGTCTCCGGAGTCGAGACATCTTGACTGATGTTGTCATTGTTGTGAGCCGTGAGCAGTTTAGAGCCCATAAAACGGTCCTCATGGCCTGCAGTGGCCTGTTCTATAGCATCTTTACAGACCAGTTGAAATGCAACCTTAGTGTGATCAATCTAGATCCTGAGATCAACCCTGAGGGATTCTGCATCCTCCTGGACTTCATGTACACATCTCGGCTCAATTTGCGGGAGGGCAACATCATGGCTGTGATGGCCACGGCTATGTACCTGCAGATGGAGCATGTTGTGGACACTTGCCGGAAGTTTATTAAGGCCAGTGAAGCAGAGATGGTTTCTGCCATCAAGCCTCCTCGTGAAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... BCL6(604)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Britta Jasmer et al.
Oncotarget, 8(65), 108643-108654 (2018-01-10)
The oncogene B-cell lymphoma 6 (BCL6) is associated with lymphomagenesis. Intriguingly, its expression is increased in preeclamptic placentas. Preeclampsia is one of the leading causes of maternal and perinatal mortality and morbidity. Preeclamptic placentas are characterized by various defects like
Min Gao et al.
Aging, 12(10), 9275-9291 (2020-05-16)
Nucleus accumbens-associated protein 1 (NAC1) has multifaceted roles in cancer pathogenesis and progression, including the development of drug resistance, promotion of cytokinesis, and maintenance of "stem cell-like" phenotypes. NAC1 is a transcriptional co-regulator belonging to the bric-a-brac tramtrack broad (BTB)
Andreas Ritter et al.
International journal of molecular sciences, 21(21) (2020-11-14)
Human placentation is a highly invasive process. Deficiency in the invasiveness of trophoblasts is associated with a spectrum of gestational diseases, such as preeclampsia (PE). The oncogene B-cell lymphoma 6 (BCL6) is involved in the migration and invasion of various
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU075421-20UG | 04061828617944 |
| EHU075421-50UG | 04061828392209 |