Skip to Content
Merck
CN

EHU075501

MISSION® esiRNA

targeting human CUX1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCAAGGAAGCTGAAGCAGCTTTCTTGAATGTCTACAAAAGATTGATTGACGTCCCAGATCCCGTACCAGCTTTGGATCTCGGACAGCAACTCCAGCTCAAAGTGCAGCGCCTGCACGATATTGAAACAGAGAACCAGAAACTTAGGGAAACTCTGGAAGAATACAACAAGGAATTTGCTGAAGTGAAAAATCAAGAGGTTACGATAAAAGCACTTAAAGAGAAAATCCGAGAATATGAACAGACACTGAAGAACCAAGCCGAAACCATAGCTCTTGAGAAGGAACAGAAGTTACAGAATGACTTTGCAGAAAAGGAGAGAAAGCTGCAGGAGACACAGATGTCCACCACCTCAAAGCTGGAGGAAGCTGAGCATAAGGTTCAGAGCCTACAAACAGCCCTGGAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Junfeng Wang et al.
Oncology reports, 37(5), 3068-3074 (2017-04-14)
The homeobox transcription factor CUTL1 has been associated with cellular proliferation and cell cycle progression, and CUTL1 functions as an oncogene. The aim of the present study was to investigate whether CUTL1 participates in epithelial-mesenchymal transition (EMT). The expression levels
Liza J Burton et al.
PloS one, 14(4), e0214844-e0214844 (2019-04-10)
Triple-Negative Breast Cancers (TNBCs) are the most difficult to treat subtype of breast cancer and are often associated with high nuclear expression of Snail and Cathepsin L (Cat L) protease. We have previously shown that Snail can increase Cat L
Xiao Zhang et al.
Neurochemical research, 45(12), 2840-2855 (2020-10-02)
Circular RNAs (circRNAs) played pivotal roles in the initiation and progression of cancers. CircRNA cut like homeobox 1 (circ-CUX1; hsa_circ_0132813) has been reported to contribute to neuroblastoma (NB) development by previous study. Furthermore, previous works reported that microRNA-16-5p (miR-16-5p) was
Tian Gao et al.
Cancer biology & medicine, 17(2), 371-386 (2020-06-27)
Objective: Osteosarcoma is a common primary highly malignant bone tumor. Kinesin family member 18B (KIF18B) has been identified as a potential oncogene involved in the development and metastasis of several cancer types. While KIF18B overexpression in osteosarcoma tissue is clearly

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service