Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGAAGCCACAATGTTCTTGGCCCATCATGACATTGGGTAGCATTAACTGTAAGTTTTGTGCTTCCAAATCACTTTTTGGTTTTTAAGAATTTCTTGATACTCTTATAGCCTGCCTTCAATTTTGATCCTTTATTCTTTCTATTTGTCAGGTGCACAAGATTACCTTCCTGTTTTAGCCTTCTGTCTTGTCACCAACCATTCTTACTTGGTGGCCATGTACTTGGAAAAAGGCCGCATGATCTTTCTGGCTCCACTCAGTGTCTAAGGCACCCTGCTTCCTTTGCTTGCATCCCACAGACTATTTCCCTCATCCTATTTACTGCAGCAAATCTCTCCTTAGTTGATGAGACTGTGTTTATCTCCCTTTAAAACCCTACCTATCCTGAATGGTCTGTCATTGTCTGCCT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... YWHAZ(7534)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wenrui Wang et al.
Cell death & disease, 8(10), e3071-e3071 (2017-10-06)
MicroRNAs (miRNAs) have been identified as major post-transcriptional regulators of the initiation and progression of human cancers, including breast cancer. However, the detail role of miR-451 has not been fully elucidated in breast cancer. In this study, we aimed to
Lei Yan et al.
Environmental toxicology, 35(9), 1015-1028 (2020-05-19)
Breast cancer (BC) is the leading cause of cancer-related death in women worldwide and one of the most prevalent malignancy. In recent years, increasing evidence had illuminated that long noncoding RNAs (lncRNAs) serve as critical factors in multiple tumor progression
Langyong Mao et al.
American journal of cancer research, 5(6), 1939-1953 (2015-08-14)
The deregulation of microRNAs has been demonstrated in various tumor processes. Here, we report that microRNA-544 (miR-544) is decreased in cervical cancer tissues compared with normal cervical tissues. To identify the mechanisms involved in miR-544 deregulation, we studied the regulation
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU076001-20UG | 04061831353358 |
| EHU076001-50UG | 04061831373059 |