Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCTCCTGCTCTTTCTCCTTCCTGGGAGCCTGGGCGCAGAAAGCCACCTCTCCCTCCTGTACCACCTTACCGCGGTGTCCTCGCCTGCCCCGGGGACTCCTGCCTTCTGGGTGTCCGGCTGGCTGGGCCCGCAGCAGTACCTGAGCTACAATAGCCTGCGGGGCGAGGCGGAGCCCTGTGGAGCTTGGGTCTGGGAAAACCAGGTGTCCTGGTATTGGGAGAAAGAGACCACAGATCTGAGGATCAAGGAGAAGCTCTTTCTGGAAGCTTTCAAAGCTTTGGGGGGAAAAGGTCCCTACACTCTGCAGGGCCTGCTGGGCTGTGAACTGGGCCCTGACAACACCTCGGTGCCCACCGCCAAGTTCGCCCTGAACGGCGAGGAGTTCATGAATTTCGACCTCAAGCAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... FCGRT(2217)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Kunihiro Ichinose et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(4), 944-952 (2015-12-05)
Kidney podocytes and their slit diaphragms prevent urinary protein loss. T cells from patients with systemic lupus erythematosus display increased expression of calcium/calmodulin-dependent protein kinase IV (CaMKIV). The present study was undertaken to investigate the role of CaMKIV in podocyte
Huiqin Liu et al.
Journal of controlled release : official journal of the Controlled Release Society, 296, 40-53 (2019-01-18)
Pancreatic ductal adenocarcinoma (PDAC) is a dominantly (~95%) KRAS-mutant cancer that has extremely poor prognosis, in part this is due to its strong intrinsic resistance towards almost all therapeutic agents. PDAC relies heavily on KRAS-transformed metabolism, including enhanced macropinocytosis and
Rafal Swiercz et al.
Oncotarget, 8(2), 3528-3541 (2016-12-16)
Tumor cells rely on high concentrations of amino acids to support their growth and proliferation. Although increased macropinocytic uptake and lysosomal degradation of the most abundant serum protein, albumin, in Ras-transformed cells can meet these demands, it is not understood
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU076011-20UG | 04061828627578 |
| EHU076011-50UG | 04061828392711 |