Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCACAACCTCACCTTCCACAAGCTGGTGGCCTATATGATCTGCCTACATACAGCTATTCACATCATTGCACACCTGTTTAACTTTGACTGCTATAGCAGAAGCCGACAGGCCACAGATGGCTCCCTTGCCTCCATTCTCTCCAGCCTATCTCATGATGAGAAAAAGGGGGGTTCTTGGCTAAATCCCATCCAGTCCCGAAACACGACAGTGGAGTATGTGACATTCACCAGCATTGCTGGTCTCACTGGAGTGATCATGACAATAGCCTTGATTCTCATGGTAACTTCAGCTACTGAGTTCATCCGGAGGAGTTATTTTGAAGTCTTCTGGTATACTCACCACCTTTTTATCTTCTATATCCTTGGCTTAGGGATTCACGGCATTGGTGGAATTGTCCGGGGTCAAACAGAGGAGAGCATGAATGAGAGTCATCCTCGCAAGTGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NOX1(27035)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
H-P Wang et al.
European review for medical and pharmacological sciences, 20(21), 4474-4481 (2016-11-23)
Reactive oxygen species (ROS) generated by endogenous metabolic enzymes are involved in a variety of pathology processes, including cancer. In particular, superoxide-generating NADPH oxidase 1 (Nox1), a member of Nox enzyme family, is highly expressed in the colon tissue and
The nuclear receptor NOR-1 modulates redox homeostasis in human vascular smooth muscle cells.
Judith Alonso et al.
Journal of molecular and cellular cardiology, 122, 23-33 (2018-08-11)
Jin-Woo Jeong et al.
International journal of molecular sciences, 20(6) (2019-03-25)
Excessive bone resorption by osteoclasts causes bone loss-related diseases and reactive oxygen species (ROS) act as second messengers in intercellular signaling pathways during osteoclast differentiation. In this study, we explored the protective effects of fermented oyster extract (FO) against receptor
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU076051-50UG | 04061828392759 |
| EHU076051-20UG | 04061831353365 |