Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGATGGAGTCCTCGTTTCAACCCAAGACTCTCGAATCAAACAGTTGGAGAATGGAGTACTGCAGATCCGATATGCTAAGCTGGGTGATACTGGTCGGTACACCTGCATTGCATCAACCCCCAGTGGTGAAGCAACATGGAGTGCTTACATTGAAGTTCAAGAATTTGGAGTTCCAGTTCAGCCTCCAAGACCTACTGACCCAAATTTAATCCCTAGTGCCCCATCAAAACCTGAAGTGACAGATGTCAGCAGAAATACAGTCACATTATCGTGGCAACCAAATTTGAATTCAGGAGCAACTCCAACATCTTATATTATAGAAGCCTTCAGCCATGCATCTGGTAGCAGCTGGCAGACCGTAGCAGAGAATGTGAAAACAGAAACATCTGCCATTAAAGGACTCAAACCTAATGCAATTTACCTTTTCCTTGTGAGGGCAGCTAAT
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ROBO1(6091)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Zongpu Zhang et al.
Aging, 13(4), 5055-5068 (2021-02-04)
Vasculogenic mimicry (VM), the formation of an alternative microvascular circulation independent of VEGF-driven angiogenesis, is reluctant to anti-angiogenesis therapy for glioma patients. However, treatments targeting VM are lacking due to the poor understanding of the molecular mechanism involved in VM
Gael Genet et al.
Nature communications, 10(1), 2350-2350 (2019-05-30)
Endothelial cell migration, proliferation and survival are triggered by VEGF-A activation of VEGFR2. However, how these cell behaviors are regulated individually is still unknown. Here we identify Endophilin-A2 (ENDOA2), a BAR-domain protein that orchestrates CLATHRIN-independent internalization, as a critical mediator
Feng Zhang et al.
Nature communications, 7, 13517-13517 (2016-11-25)
Vascular permeability and neovascularization are implicated in many diseases including retinopathies and diabetic wound healing. Robo4 is an endothelial-specific transmembrane receptor that stabilizes the vasculature, as shown in Robo4
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU076591-50UG | 04061828393299 |
| EHU076591-20UG | 04061831353433 |