Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTCTCGGACCTCACAGTCAGTTCCAGATATAACAGATCGGCCGCCTCATTCTCTGCACTCCATGCCAACTGATGGTCAGCTAGACGGCACGTATCCACCGCCCGTCCATGATGACAATGTGTCTATGGCTTCATCTGGGGCCACCCAAGCTGAACTTATGACCTTAACCATTGTGAAAGGTGCCCAGGGCTTCGGCTTCACTATTGCCGACAGTCCTACAGGACAGCGGGTGAAACAAATACTTGACATTCAGGGATGCCCTGGCCTGTGTGAAGGCGACCTCATTGTTGAGATCAACCAGCAGAATGTACAGAACCTGAGCCATACAGAAGTAGTGGATATACTTAAGGACTGTCCCATTGGAAGTGAAACTTCTTTGATTATCCATCGAGGAGGTTTCTTTTCTCCATGGAAAACTCCAAAGCCTATAATGGACCGATGGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MAGI2(9863)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Eun-Hee Lee et al.
Scientific reports, 7(1), 5759-5759 (2017-07-20)
Axl receptor tyrosine kinase is involved in the tumorigenesis and metastasis of many cancers. Axl expression was markedly higher in human papilloma virus type 16E6 (HPV16E6)-overexpressing HeLa (HE6F) cells and lower in HPV16E6-suppressing CaSki (CE6R) cells than in the controls.
Blanca L Valle et al.
Cancer prevention research (Philadelphia, Pa.), 13(9), 783-794 (2020-06-26)
Molecular alterations that contribute to long-term (LT) and short-term (ST) survival in ovarian high-grade serous carcinoma (HGSC) may be used as precision medicine biomarkers. DNA promoter methylation is an early event in tumorigenesis, which can be detected in blood and
Saurabh Pandey et al.
The Journal of biological chemistry, 295(25), 8575-8588 (2020-05-08)
Group I metabotropic glutamate receptors (mGluRs) play important roles in various neuronal functions and have also been implicated in multiple neuropsychiatric disorders like fragile X syndrome, autism, and others. mGluR trafficking not only plays important roles in controlling the spatiotemporal
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU076621-50UG | 04061828393312 |
| EHU076621-20UG | 04061828628094 |