Skip to Content
Merck
CN

EHU076621

Sigma-Aldrich

MISSION® esiRNA

targeting human MAGI2

Sign Into View Organizational & Contract Pricing

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCTCGGACCTCACAGTCAGTTCCAGATATAACAGATCGGCCGCCTCATTCTCTGCACTCCATGCCAACTGATGGTCAGCTAGACGGCACGTATCCACCGCCCGTCCATGATGACAATGTGTCTATGGCTTCATCTGGGGCCACCCAAGCTGAACTTATGACCTTAACCATTGTGAAAGGTGCCCAGGGCTTCGGCTTCACTATTGCCGACAGTCCTACAGGACAGCGGGTGAAACAAATACTTGACATTCAGGGATGCCCTGGCCTGTGTGAAGGCGACCTCATTGTTGAGATCAACCAGCAGAATGTACAGAACCTGAGCCATACAGAAGTAGTGGATATACTTAAGGACTGTCCCATTGGAAGTGAAACTTCTTTGATTATCCATCGAGGAGGTTTCTTTTCTCCATGGAAAACTCCAAAGCCTATAATGGACCGATGGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eun-Hee Lee et al.
Scientific reports, 7(1), 5759-5759 (2017-07-20)
Axl receptor tyrosine kinase is involved in the tumorigenesis and metastasis of many cancers. Axl expression was markedly higher in human papilloma virus type 16E6 (HPV16E6)-overexpressing HeLa (HE6F) cells and lower in HPV16E6-suppressing CaSki (CE6R) cells than in the controls.
Blanca L Valle et al.
Cancer prevention research (Philadelphia, Pa.), 13(9), 783-794 (2020-06-26)
Molecular alterations that contribute to long-term (LT) and short-term (ST) survival in ovarian high-grade serous carcinoma (HGSC) may be used as precision medicine biomarkers. DNA promoter methylation is an early event in tumorigenesis, which can be detected in blood and
Saurabh Pandey et al.
The Journal of biological chemistry, 295(25), 8575-8588 (2020-05-08)
Group I metabotropic glutamate receptors (mGluRs) play important roles in various neuronal functions and have also been implicated in multiple neuropsychiatric disorders like fragile X syndrome, autism, and others. mGluR trafficking not only plays important roles in controlling the spatiotemporal

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service