Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTCGCGGGAAATTTATCAAGCCATGGGAGAGTCCAGATGAAATGGAATTAGATGAGCTGCTTAAGGAGATATCTAGGAAGCGCAGAAGCATCCGTTATGGGAGAGAAGTTGAATTAAAGCCATATATTGCCGCTCACTTTGATGTCCTTCCCACTGAGTTCACCCTGGGGGATGACAAGCATTATGGTGGATTTACAAACAAGCAACTCCAAAGTGGTCAAGAATATGTCTTCTTTGTGTTAGCAGTAATGGAACATGCAGAGTCTAAGATGTATGCAACCAGCCCTTACTCCGACCCCGTGGTGTCAATGGATCTGGATCCGCAGCCAATCACGGATGAAGAAGAAGGCTTGATCTGGGTTGTAGGTCCTGTCCTTGCAGTGGTCTTTATCATCTGCATTGTCATTGCTATTCTTCTTTATAAAAGGAAGAGGGCAGAGTCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PTPRD(5789)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Won Jung Bae et al.
Journal of experimental & clinical cancer research : CR, 38(1), 484-484 (2019-12-07)
Protein tyrosine phosphatase receptor delta (PTPRD) is frequently inactivated in various types of cancers. Here, we explored the underlying mechanism of PTPRD-loss-induced cancer metastasis and investigated an efficient treatment option for PTPRD-inactivated gastric cancers (GCs). PTPRD expression was evaluated by
Dandan Wang et al.
PloS one, 9(11), e113754-e113754 (2014-11-21)
PTPRD, encoding protein tyrosine phosphatases receptor type D, is located at chromosome 9p23-24.1, a loci frequently lost in many types of tumors. Recently, PTPRD has been proposed to function as a tumor suppressor gene. The current study aimed to investigate
Yng-Tay Chen et al.
Oncotarget, 6(15), 12997-13005 (2015-06-17)
Genome-wide association study (GWAS) data showed that the protein tyrosine phosphatase receptor type delta (PTPRD) is associated with increased susceptibility to type 2 diabetes (T2D) in Han Chinese. A replication study indicated that PTPRD is involved in the insulin signaling
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU077591-50UG | 04061828401116 |
| EHU077591-20UG | 04061828628759 |