Skip to Content
Merck
CN

EHU077591

MISSION® esiRNA

targeting human PTPRD

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCGCGGGAAATTTATCAAGCCATGGGAGAGTCCAGATGAAATGGAATTAGATGAGCTGCTTAAGGAGATATCTAGGAAGCGCAGAAGCATCCGTTATGGGAGAGAAGTTGAATTAAAGCCATATATTGCCGCTCACTTTGATGTCCTTCCCACTGAGTTCACCCTGGGGGATGACAAGCATTATGGTGGATTTACAAACAAGCAACTCCAAAGTGGTCAAGAATATGTCTTCTTTGTGTTAGCAGTAATGGAACATGCAGAGTCTAAGATGTATGCAACCAGCCCTTACTCCGACCCCGTGGTGTCAATGGATCTGGATCCGCAGCCAATCACGGATGAAGAAGAAGGCTTGATCTGGGTTGTAGGTCCTGTCCTTGCAGTGGTCTTTATCATCTGCATTGTCATTGCTATTCTTCTTTATAAAAGGAAGAGGGCAGAGTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Won Jung Bae et al.
Journal of experimental & clinical cancer research : CR, 38(1), 484-484 (2019-12-07)
Protein tyrosine phosphatase receptor delta (PTPRD) is frequently inactivated in various types of cancers. Here, we explored the underlying mechanism of PTPRD-loss-induced cancer metastasis and investigated an efficient treatment option for PTPRD-inactivated gastric cancers (GCs). PTPRD expression was evaluated by
Yng-Tay Chen et al.
Oncotarget, 6(15), 12997-13005 (2015-06-17)
Genome-wide association study (GWAS) data showed that the protein tyrosine phosphatase receptor type delta (PTPRD) is associated with increased susceptibility to type 2 diabetes (T2D) in Han Chinese. A replication study indicated that PTPRD is involved in the insulin signaling
Dandan Wang et al.
PloS one, 9(11), e113754-e113754 (2014-11-21)
PTPRD, encoding protein tyrosine phosphatases receptor type D, is located at chromosome 9p23-24.1, a loci frequently lost in many types of tumors. Recently, PTPRD has been proposed to function as a tumor suppressor gene. The current study aimed to investigate

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service