Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAAGAGCAAATGGCCTACCTCCAACAGAAAGAGCTGGACCTGATAGATTATAAATTTGGAGAACGTAAAAAAGATGGTGATCCAGATTCCCAGGAACAACAGTTACTGGATTTCTCTGAACCCGACTGTCCCTCTTCATCTGCAAACAGTAGAAAAGACAAGTCTCTGAGAATTATGAGCCAGAAGTTTGTCATGCTGTTCCTCGTCTCCAAAACCAAGATTGTCACTCTGGATGTGGCTGCCAAAATACTGATAGAAGAAAGCCAAGATGCCCCAGACCATAGTAAATTTAAAACAAAGGTACGACGCCTCTATGACATAGCCAATGTTCTGACCAGCTTGGCTCTGATAAAGAAAGTGCATGTAACAGAAGAGCGAGGTCGTAAACCAGCCTTCAAGTGGATC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... E2F7(144455)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Rui Yang et al.
British journal of cancer, 123(9), 1445-1455 (2020-08-21)
E2F transcription factors are considered to be important drivers of tumour growth. E2F7 is an atypical E2F factor, and its role in glioblastoma remains undefined. E2F7 expression was examined in patients by IHC and qRT-PCR. The overall survival probability was
Weihong Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 104, 94-101 (2018-05-18)
Colorectal cancer (CRC) is one of the most common malignancies with high morbidity and mortality rates worldwide. This study aimed to investigate whether miR-3666 was involved in inhibitory effects of all-transretinoic acid (ATRA) on the development of colorectal cancer (CRC).
Hendrika A Segeren et al.
Cell reports, 33(9), 108449-108449 (2020-12-03)
E2F transcription factors control the expression of cell-cycle genes. Cancers often demonstrate enhanced E2F target gene expression, which can be explained by increased percentages of replicating cells. However, we demonstrate in human cancer biopsy specimens that individual neoplastic cells display
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU077721-20UG | 04061828628841 |
| EHU077721-50UG | 04061831373196 |