Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGTGTCGTGAATTTCGAAGCATGCAGAGAAATGGAAAGCTTATCTGCACCAGAGAAAATAACCCTGTTCGAGGCCCATATGGCAAGATGCACATCAATAAATGTGCTATGTGTCAGAGCATCTTTGATCGAGAAGCTAATGAAAGAAAAAAGAAAGATGAAGAGAAATCAAGTAGCAAGCCCTCAAATAATGCAAAGGATGAGTGCAGTGAATTTCGAAACTATATAAGGAACAATGAACTCATCTGCCCTAGAGAGAATGACCCAGTGCACGGTGCTGATGGAAAGTTCTATACAAACAAGTGCTACATGTGCAGAGCTGTCTTTCTAACAGAAGCTTTGGAAAGGGCAAAGCTTCAAGAAAAGCCATCCCATGTTAGAGCTTCTCAAGAGGAAGACAGCCCAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SPINK5(11005)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Michael R Williams et al.
Cell reports, 30(9), 2923-2933 (2020-03-05)
Netherton syndrome (NS) is a monogenic skin disease resulting from loss of function of lymphoepithelial Kazal-type-related protease inhibitor (LEKTI-1). In this study we examine if bacteria residing on the skin are influenced by the loss of LEKTI-1 and if interaction
Tengwei Cao et al.
PloS one, 9(8), e103793-e103793 (2014-08-08)
Atrial hypertrophy and fibrosis are essential pathological features of atrial fibrillation. Recently, adiponectin has become a protein of interest due to its beneficial effects on cardiovascular diseases. However, the molecular mechanism of atrial structural remodeling and signaling pathways evoked by
Mei-Hong Li et al.
Journal of pediatric surgery, 49(8), 1286-1291 (2014-08-06)
Neuroblastoma (NB) is the most common extracranial solid tumor of childhood. Preliminary data derived from a human angiogenesis array in NB showed that the bioactive lipid sphingosine-1-phosphate (S1P) induced the secretion of several angiogenesis-related proteins including the important inflammatory factor
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU077751-20UG | 04061828628872 |
| EHU077751-50UG | 04061828401246 |