Skip to Content
Merck
CN

EHU078041

MISSION® esiRNA

targeting human PMAIP1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCTCAGGAGGTGCACGTTTCATCAATTTGAAGAAAGACTGCATTGTAATTGAGAGGAATGTGAAGGTGCATTCATGGGTGCCCTTGGAAACGGAAGATGGAATACATCAAAGTGAATTTCTGTTCAAGTTTTCCCAGATTATCATTCTTTGGGATGAGAGAACATTATAAAACCACTTTGTTTATTTTAAAGCAAGAATGGAAGACCCTTGAAAATAAAGAAGTAATTATTGACACATTTCTTTTTTACTTAGAGAATCGTTCTAGTGTTTTTGCCGAAGATTACCGCTGGCCTACTGTGAAGGGAGATGACCTGTGATTAGACTGGGCGGCTGGGGAGAAACAGTTCAGTGCATTGTTGTTGTTGCTGTTTTTGGTGTTTTGCTTTTCAGTGCCAACTCAGCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PMAIP1(5366)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhenqian Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 95, 1574-1579 (2017-09-28)
Colorectal cancer (CRC) cells undergo apoptosis in the presence of the small-molecule inhibitor ABT-263 by up-regulating antiapoptotic Bcl-2 family members. However, the resistance to ABT-263 gradually developed in most solid tumors due to its low affinity to Mcl-1. Here, we
Yohei Sugimoto et al.
Molecular cancer therapeutics, 19(10), 1992-2000 (2020-08-28)
Rhabdoid tumor is an aggressive, early childhood tumor. Biallelic inactivation of the SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1 (SMARCB1)/integrase interactor 1 (INI1) gene is the only common genetic feature in rhabdoid tumors. Loss of SMARCB1 function
Eugene Y Kim et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, fj201800425R-fj201800425R (2018-05-26)
Rheumatoid arthritis (RA) is characterized by hyperplastic pannus formation mediated by activated synovial fibroblasts (RASFs) that cause joint destruction. We have shown earlier that RASFs exhibit resistance to apoptosis, primarily as a result of enhanced expression of myeloid cell leukemia-1
Yoon A Jeong et al.
Nutrients, 11(9) (2019-09-01)
Although the anticancer activity of Korean Red Ginseng (KRG) has been known in various cancers, the mechanism of KRG-induced apoptosis is unknown in colorectal cancer (CRC). In our study, we examined whether KRG induces apoptosis in CRC cells. In the
Liz J Hernandez-Borrero et al.
Cell cycle (Georgetown, Tex.), 17(5), 557-567 (2017-07-28)
P53 tumor suppressor gene mutations occur in the majority of human cancers and contribute to tumor development, progression and therapy resistance. Direct functional restoration of p53 as a transcription factor has been difficult to achieve in the clinic. We performed

Global Trade Item Number

SKUGTIN
EHU078041-50UG04061828401512
EHU078041-20UG04061831363128

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service