Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCAAGAGGCTGAGGACTTTGCCCAGGATGACATAGCCAATGGACAAGCAGTGTCTGTCAGCTGTGAAGGCTTCACTCTTATTGTCCTTCTACCTTGAATAGAAGTTTTCCTGATAAGAATAAACGAGGAAAAGGTCCTTGCCTCCTGGAAGAACAAATCTACCAGGTGATCTATTCATTGTTTCAACTCAGAATGCACTTGATTCAGGAGGTCATCTGACCTTCACCTTGGATGGTTAGTTTCACTTTTTACATATAGTTTTTGCAGGGTTTTATTTTATAAAATCCAAGCGCGCTGTTGATTGTGTTTTCCTTGTTTTCAGCCCCCCCACTCCAGCCCGCAGCACATTTCCGCTGTCCGTCAGTAATTGTGTCCTCTCTTTATGCTTGCTTGGGGAATGTTGTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ATP7B(540)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Junko Fujiyoshi et al.
Scientific reports, 9(1), 1535-1535 (2019-02-09)
Wilson's disease (WD) is an inherited metabolic disease arising from ATPase copper transporting beta gene (ATP7B) mutation. Orthotoropic liver transplantation is the only radical treatment of fulminant WD, although appropriate donors are lacking at the onset of emergency. Given the
Navasona Krishnan et al.
Genes & development, 32(13-14), 944-952 (2018-06-28)
The levels of copper, which is an essential element in living organisms, are under tight homeostatic control. Inactivating mutations in ATP7B, a P-type Cu-ATPase that functions in copper excretion, promote aberrant accumulation of the metal, primarily the in liver and
Marta Mariniello et al.
Cancers, 12(3) (2020-03-12)
Tumor resistance to chemotherapy represents an important challenge in modern oncology. Although platinum (Pt)-based drugs have demonstrated excellent therapeutic potential, their effectiveness in a wide range of tumors is limited by the development of resistance mechanisms. One of these mechanisms
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU078371-20UG | 04061831363173 |
| EHU078371-50UG | 04061828401840 |