Skip to Content
Merck
CN

EHU078741

MISSION® esiRNA

targeting human GAB2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCCCAAACAATGACTTCCTGCCATGTTTGATGGGGACAGCTACCACTGTCCTCTGCCCCCATTCCCCTTTCAGCTCCCATGAGCATGCATAGTTCACCAGACCAATGGCCTAGCCATTCTCTAAGTCCCATCCTGGAAGAAGTTATTTCTTCAAGAGCTGCACCTCTCCTCCTAGCATTAGTTTAGATCAACTCAAGGAGTATTTATTAATGGCTGCTGTCTCCAGTTTCTGGGGTTAAGCACTAAGGACACAAGAATCAATCAGACCTTCTCCCTGAACTTAAGATAGCCACAATCAGAAAAAGGACAAGGACATGAGACAGTGGTGATGGCCATCAGACAGAGACTTCAAATGCTGATGGAGGGCAGAGGAAGTACTTAGGGAGGTTGGTGTCAGAGGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GAB2(9846)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiang-Rui Qiao et al.
Oncology letters, 20(4), 99-99 (2020-08-25)
The development of prostate cancer is complicated and involves a number of tumor-associated gene expression level abnormalities. Gene chip technology is a high-throughput method that can detect gene expression levels in different tissues and cells on a large scale. In
Peng Zhang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(1), 52-65 (2018-10-17)
HER2 has been implicated in mammary tumorigenesis as well as aggressive tumor growth and metastasis. Its overexpression is related to a poor prognosis and chemoresistance in breast cancer patients. Although Grb2-associated binding protein 2 (Gab2) is important in the development
Jiuhong Ma et al.
Oncology reports, 37(2), 1159-1167 (2016-12-22)
Glioma is the most frequent and aggressive primary tumor of the brain in humans. Over the last few decades, significant progress has been made in early detection and multi-mode treatments, but the prognosis of gliomas is still extremely poor. MicroRNAs
Yiping Huang et al.
Biochemical and biophysical research communications, 503(3), 2028-2032 (2018-08-11)
The functionality of lncRNA snaR has only been characterized in breast cancer and colon cancer. The aim of the current study is to explore the involvement of lncRNA snaR in ovarian carcinoma (OC). Expression of lncRNA snaR and GRB2-associated binding
Wen Jie Wang et al.
International journal of clinical and experimental pathology, 8(9), 10575-10584 (2015-12-01)
Non-small cell lung cancer (NSCLC) is a leading cause of cancer-related death and often has a poor prognosis. Investigation of NSCLC cancer cell migration, invasion and development of strategies to block this process is essential to improve the disease prognosis.

Global Trade Item Number

SKUGTIN
EHU078741-20UG04061828629732
EHU078741-50UG04061828402212

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service