Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCCTGGAGTCCTACATCTCACAGCAGAAGACGGGCGTGGGAGGGACTGGAATTGACATCCCTGTCCTGCTCCTCCTGATTGATGGTGATGAGAAGATGTTGACGCGAATAGAGAACGCCACCCAGGCTCAGCTCCCATGTCTCCTCGTGGCTGGCTCAGGGGGAGCTGCGGACTGCCTGGCGGAGACCCTGGAAGACACTCTGGCCCCAGGGAGTGGGGGAGCCAGGCAAGGCGAAGCCCGAGATCGAATCAGGCGTTTCTTTCCCAAAGGGGACCTTGAGGTCCTGCAGGCCCAGGTGGAGAGGATTATGACCCGGAAGGAGCTCCTGACAGTCTATTCTTCTGAGGATGGGTCTGAGGAATTCGAGACCATAGTTTTGAAGGCCCTTGTGAAGGCCTGTGGGAGCTCGGAGGCCTCAGCCTACCTGGATGAGCTGCGTT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TRPM4(54795)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xi Hong et al.
American journal of physiology. Cell physiology, 316(4), C463-C480 (2018-12-20)
Prostate cancer (PCa) remains one of the leading causes of cancer-related deaths among males. The aim of the current study was to investigate the ability of microRNA-150 (miR-150) targeting transient receptor potential melastatin 4 (TRPM4) to mediate epithelial-mesenchymal transition (EMT)
Fujue Wang et al.
Cellular signalling, 72, 109643-109643 (2020-04-23)
Transient Receptor Potential Melastatin Subfamily Member 4 (TRPM4) has been demonstrated to be aberrantly expressed in several cancers but seldom reported in acute leukemia. Based on database mining and validated experiments, our present data show that TRPM4 is selectively overexpressed
Elías Leiva-Salcedo et al.
Channels (Austin, Tex.), 11(6), 624-635 (2017-09-07)
Cerebral ischemia-reperfusion injury triggers a deleterious process ending in neuronal death. This process has two components, a glutamate-dependent and a glutamate-independent mechanism. In the glutamate-independent mechanism, neurons undergo a slow depolarization eventually leading to neuronal death. However, little is known
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU078761-20UG | 04061831363234 |
| EHU078761-50UG | 04061828402229 |