Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TFRC(7037)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yihe Wu et al.
Thoracic cancer, 9(2), 253-261 (2017-12-30)
Transferrin receptor (TfR) is expressed in most lung cancers and is an indicator of poor prognosis in certain groups of patients. In this study, we blocked cell surface TfR to inhibit lung adenocarcinoma (LAC) cell growth in vitro and investigated
Hongwei Su et al.
Molecular cancer, 18(1), 27-27 (2019-02-21)
Circular RNA (circRNA) represents a broad and diverse endogenous RNAs that can regulate gene expression in cancer. However, the regulation and function of bladder cancer (BC) circRNAs remain largely unknown. Here we generated circRNA microarray data from three BC tissues
Tian Tang et al.
Singapore medical journal, 62(2), 96-103 (2019-11-05)
Dihydroartemisinin (DHA) is a first-line antimalarial drug with relatively low toxicity. DHA has been speculated to possess a broad-spectrum antitumour effect. However, the potential value of DHA for the treatment of endometrial carcinoma or cervical cancer is unclear. We used
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU078971-20UG | 04061831363272 |
| EHU078971-50UG | 04061831373257 |