Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAAAAGCAACTGCACAAGACAACCCCAAATCTGCCACAGAGCAGTCAGGAACTGGTATCCGATCAGAGAGTGAGACAGAGTCCGAGGCCTCAGAAATTACTATTCCTCCCAGCACCCCGGCAGTTCCACAGGCTCCCGTCCAGGGGGAGGACTACGGCAAAGGTGTCATCTTCTACCTCAGGGACAAAGTGGTCGTGGGGATTGTGCTATGGAACATCTTTAACCGAATGCCAATAGCAAGGAAGATCATTAAGGACGGTGAGCAGCATGAAGATCTCAATGAAGTAGCCAAACTATTCAACATTCATGAAGACTGAAGCCCCACAGTGGAATTGGCAAACCCACTGCAGCCCCTGAGAGGAGGTCGAATGGGTAAAGGAGCATTTTTTTATTCAGCAGACTTTCTCTGTGTATGAGTGTGAATGATCAAGTCCTTTGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... AIFM1(9131)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mausumi Basu et al.
PLoS pathogens, 13(2), e1006240-e1006240 (2017-02-28)
Oxidative stress activates the cellular kinase HRI, which then phosphorylates eIF2α, resulting in stalled translation initiation and the formation of stress granules (SGs). SG assembly redirects cellular translation to stress response mRNAs and inhibits cap-dependent viral RNA translation. Flavivirus infections
Chongcheng Wang et al.
Cell death & disease, 11(8), 630-630 (2020-08-18)
Induction of lethal autophagy has become a strategy to eliminate glioma cells, but it remains elusive whether autophagy contributes to cell death via causing mitochondria damage and nuclear translocation of apoptosis inducing factor (AIF). In this study, we find that
Hongwei Zhao et al.
Cancer letters, 374(1), 136-148 (2016-02-09)
Programmed necrosis is established as a new form of programmed cell death and is emerging as a new strategy of treatment for cancers. Pristimerin is a natural chemical with anti-tumor effect despite the fact that its mechanism remains poorly understood.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU079251-20UG | 04061828630141 |
| EHU079251-50UG | 04061828402670 |