Skip to Content
Merck
CN

EHU079681

MISSION® esiRNA

targeting human S1PR1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCCTCCTCAACGTTCTTTTACTTTATACTTTAACTACCTGAGAGTTATCAGAGCTGGGGTTGTGGAATGATCGATCATCTATAGCAAATAGGCTATGTTGAGTACGTAGGCTGTGGGAAGATGAAGATGGTTTGGAGGTGTAAAACAATGTCCTTCGCTGAGGCCAAAGTTTCCATGTAAGCGGGATCCGTTTTTTGGAATTTGGTTGAAGTCACTTTGATTTCTTTAAAAAACATCTTTTCAATGAAATGTGTTACCATTTCATATCCATTGAAGCCGAAATCTGCATAAGGAAGCCCACTTTATCTAAATGATATTAGCCAGGATCCTTGGTGTCCTAGGAGAAACAGACAAGCAAAACAAAGTGAAAACCGAATGGATTAACTTTTGCAAACCAAGGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... S1PR1(1901)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Regulatory Information

新产品

This item has


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Akira Nomachi et al.
PloS one, 8(12), e82590-e82590 (2013-12-21)
The lipid mediator sphingosine 1-phosphate (S1P) regulates a wide range of cellular activities, including vascular maturation, angiogenesis, and immune-cell trafficking. Among the five known receptors for S1P (S1PR1-S1PR5), S1PR1 is a critical regulator of lymphocyte trafficking: its signaling is required
Lan Xiao et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 33(6), 1090-1104 (2018-01-30)
Accumulating evidence indicates that the immune and skeletal systems interact with each other through various regulators during the osteoclastogenic process. Among these regulators, the bioactive lipid sphingosine-1-phosphate (S1P), which is synthesized by sphingosine kinase 1/2 (SPHK1/2), has recently been recognized
Veronica Lifshitz et al.
Molecular cancer therapeutics, 16(11), 2516-2527 (2017-07-19)
Drug resistance is a major barrier for the development of effective and durable cancer therapies. Overcoming this challenge requires further defining the cellular and molecular mechanisms underlying drug resistance, both acquired and environment-mediated drug resistance (EMDR). Here, using neuroblastoma (NB)
Shilun Zuo et al.
Molecular neurobiology, 54(2), 1213-1228 (2016-01-29)
Blood-brain barrier preservation plays an important role in attenuating vasogenic brain edema after subarachnoid hemorrhage (SAH). This study was designed to investigate the protective effect and mechanism of artesunate, a traditional anti-malaria drug, on blood-brain barrier after SAH. Three hundred
Zhi Zheng et al.
International immunopharmacology, 66, 224-235 (2018-11-27)
Inflammation-induced lymphangiogenesis is a widely accepted concept. However, most of the inflammatory factors and their related mechanisms have not been clarified. It has been reported that sphingosine-1-phosphate (S1P) is not only closely related to the chronic inflammatory process but also

Global Trade Item Number

SKUGTIN
EHU079681-50UG04061831373301
EHU079681-20UG04061831363371

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service