Skip to Content
Merck
CN

EHU080901

Sigma-Aldrich

MISSION® esiRNA

targeting human DLX4

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGAAAAAGGAATGGAGCAGAGCCTGTACCCCTAACCCTAACAGCTAAATCAAGGACCTCAGCCTTATATAATCATTGTCCCCACCACTACCATGGACTGGACACCTTCACTCCAGCTGGACAAAGACTCTGGAGAGAGAGCCATTGGCTGGAGTTGAGACTGTCCCCAGAACCCTTGGTCTTGCCACTCCCCCACTCCTTCTTCCCTCTCTCCCTTTCTCCTCTCCCTGCTTTCTTGAAAAGGACTGAATCGCCACTACAGCCTGGGTGCAAAATCAGCAAGAAACATTGAGTATTTTTTTTTCTTTGTATGCCTTTGGCCTTGCACAACCCATTTGTGAGCAAAAGCAGAAGTGGACCACCATCAGCTCCCACCCACCCAGCGATTTTTCCTTGGAGGTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Information

新产品
This item has

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yinxiang Lv et al.
Drug design, development and therapy, 10, 3053-3064 (2016-10-13)
Resistance to chemotherapeutic drugs is a major obstacle in non-small cell lung cancer (NSCLC) therapy. The molecular determinants of NSCLC resistance to doxorubicin are unknown. In the present study, we investigated whether topoisomerase IIβ binding protein 1 (TopBP1) was involved
Yinxiang Lv et al.
Anti-cancer drugs, 28(8), 861-868 (2017-06-20)
Calcein acetoxymethyl ester (calcein-AM) treatment has been reported to exert antitumor effects in certain cancer cells; however, the detailed mechanism of action of calcein-AM in cancers remains unclear, especially in nonsmall cell lung cancer (NSCLC). This study focused on the
Balabhadrapatruni V S K Chakravarthi et al.
Molecular cancer research : MCR, 16(7), 1125-1137 (2017-10-14)
In aggressive prostate cancers, the oncoprotein STMN1 (also known as stathmin 1 and oncoprotein 18) is often overexpressed. STMN1 is involved in various cellular processes, including cell proliferation, motility, and tumor metastasis. Here, it was found that the expression of
Shiyuan Hong et al.
Oncogene, 38(17), 3274-3287 (2019-01-12)
High-risk human papillomaviruses (HPVs) constitutively activate ataxia telangiectasia mutated (ATM) and ataxia telangiectasia- and Rad3-related (ATR) DNA damage repair pathways for viral genome amplification. HPVs activate these pathways through the immune regulator STAT-5. For the ATR pathway, STAT-5 increases expression
Rune Troelsgaard Pedersen et al.
The Journal of cell biology, 210(4), 565-582 (2015-08-19)
Genome integrity is critically dependent on timely DNA replication and accurate chromosome segregation. Replication stress delays replication into G2/M, which in turn impairs proper chromosome segregation and inflicts DNA damage on the daughter cells. Here we show that TopBP1 forms

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service